ID: 1080036337

View in Genome Browser
Species Human (GRCh38)
Location 11:27715791-27715813
Sequence CCTCATCTGTAAAAGGTGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 584
Summary {0: 1, 1: 0, 2: 7, 3: 76, 4: 500}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080036337 Original CRISPR CCTCATCTGTAAAAGGTGAT TGG Intronic
900457157 1:2782759-2782781 CCTCCTCTGTAAAAGGAGGAGGG - Intronic
900748551 1:4378139-4378161 CCTCAGCTATAAAGGGAGATGGG + Intergenic
901258367 1:7851750-7851772 CATCATCTGTAAATGCTGATAGG + Intronic
901776319 1:11562884-11562906 TCTCATCTGTAAAATGGGAGTGG + Intergenic
901809571 1:11759834-11759856 CCTCATATGTAAAAGGGGGATGG - Intergenic
902273453 1:15323179-15323201 CCTCCTCTGTGCATGGTGATAGG - Intronic
902623468 1:17663748-17663770 CCCCATCTGTAAAATGGGGTGGG - Intronic
902657397 1:17878798-17878820 CCTCATCTGTAAAATAGGAAGGG - Intergenic
902689452 1:18101123-18101145 CCTCATCTGTAAAATGGGACTGG - Intergenic
902708355 1:18221965-18221987 CCTCATCTGTAAAATGAGAAGGG - Intronic
903189016 1:21646054-21646076 CCTCATCTGTAAAATGGGGATGG + Intronic
903306708 1:22418000-22418022 CCTCATCTGTAAAGTGGGAGTGG + Intergenic
903497990 1:23784014-23784036 CCTCATCTGTAAAATGGGAATGG - Intronic
903740355 1:25555089-25555111 CCTCATCTGTAAAATGGGGGTGG + Intronic
903774323 1:25782994-25783016 CCTCGTGTGTAAAATGGGATAGG + Intronic
903808440 1:26021536-26021558 CCTCATCTGTAAGAAATGACAGG + Intronic
903853994 1:26325112-26325134 CCCCATCTGTAAAATGTGAGGGG + Intronic
903993631 1:27290784-27290806 CCTCATCTGTAAAAGGAAAGAGG - Intronic
904008861 1:27378705-27378727 CCTCATCTGTAAAGGGGCAAGGG + Intergenic
904035194 1:27555296-27555318 CCTCATCTGTAAAATGGGAGGGG - Intronic
904254954 1:29248980-29249002 CCTCACCTGTAAAATGAGAGTGG - Intronic
904344662 1:29859933-29859955 CCTCATCTGTAGGTGGGGATAGG + Intergenic
904403232 1:30270463-30270485 CCTCACCTGTAACAGGTAAAAGG + Intergenic
904774510 1:32898474-32898496 CCTCATCCATAAAAGGGGTTCGG + Intronic
904899407 1:33844700-33844722 CCTCAACTGTAAAATGGGACGGG + Intronic
905270914 1:36786896-36786918 CCTCATCTGGAAAATGGGGTTGG - Intergenic
905383667 1:37583517-37583539 CCTCATCGATAAAAGGAGAGGGG + Intronic
905444057 1:38013378-38013400 CCTCATCTGTATAATGGGAATGG - Intronic
905454373 1:38077693-38077715 CCCAATCTGAAGAAGGTGATGGG - Intergenic
905562080 1:38935489-38935511 CATCATCTGTAAAAGGAGGGTGG + Intronic
905827701 1:41038741-41038763 CCTCATCTGCAGAAGGAGGTGGG - Intronic
906836890 1:49093202-49093224 CCTCATCAGCAAAAGATGCTGGG - Intronic
907552623 1:55317245-55317267 CCTCATCTTTAAATTGTGAAAGG - Intergenic
910264857 1:85327709-85327731 CCTCAGCAGTAAAATGGGATGGG + Intronic
910743504 1:90547880-90547902 CCTCATCTGTAAAATGGGGCTGG + Intergenic
910749385 1:90612178-90612200 CCTCATCTGTGAAATGGGCTAGG - Intergenic
911498266 1:98656783-98656805 CCTCATCTGTAAAATGGGGATGG + Intergenic
912725244 1:112053485-112053507 CCTCATCTATAAAATGTGGTAGG + Intergenic
916312135 1:163409359-163409381 CCTCATCTGTAAGATGTTACTGG - Intergenic
917087639 1:171319557-171319579 TCTCACCTGTAAAATGTGAATGG - Intronic
918118376 1:181516441-181516463 CTTCATCTGTAAAATGGGACTGG - Intronic
918324110 1:183393322-183393344 CCTCATCTGTAAAATGGGATTGG - Intronic
918655140 1:187016097-187016119 CCTCATCTCTAAAATGAGAATGG + Intergenic
919850215 1:201667435-201667457 CCTCATCTGTCAGATGGGATGGG - Intronic
920095584 1:203484348-203484370 CCTCATCTGTAAAGTGAGAATGG + Intronic
920177403 1:204111270-204111292 CCTCATCTGTAAAATGAGCATGG - Intronic
920712370 1:208307330-208307352 TCTCATCTGTAAAAGGGGCTTGG - Intergenic
920971397 1:210746334-210746356 CCTCATCTGTAAAATGAAAGGGG - Intronic
921464751 1:215474130-215474152 CCTCATCTGTTAGATGTGAATGG + Intergenic
921630874 1:217432185-217432207 CCTTATTTGAAAAAGGAGATTGG + Intronic
922145080 1:222935254-222935276 ACTCTTCTGAAAAAGGTGGTTGG + Intronic
924219883 1:241863221-241863243 CCTCATCTGTAAAATGAGAATGG - Intronic
1063172172 10:3518591-3518613 CCTCATCTTTAAAAAAAGATGGG - Intergenic
1063438039 10:6050331-6050353 CCTCATCCGTAAAATGGGAATGG + Intronic
1063470280 10:6278941-6278963 CCTTATCTGTAAAACGAGATAGG + Intergenic
1064667560 10:17671851-17671873 CCTCATTTTGAAAAGTTGATTGG + Intronic
1064893349 10:20205789-20205811 CCTCATCTGTAAGATGAGGTGGG - Intronic
1066619823 10:37335179-37335201 CCTCTTCAGTAAATGGTGCTGGG - Intronic
1067688231 10:48480750-48480772 TCTCATCTGTAAAATGTGGTTGG - Intronic
1068870379 10:61937065-61937087 CCTCATCAGTAAAATGAGAAAGG + Intronic
1070756336 10:78995745-78995767 CCTCAACTGTAAGTGGGGATGGG - Intergenic
1071200164 10:83212954-83212976 ACTCATCTGTGAAAGGAAATTGG - Intergenic
1071693848 10:87851523-87851545 CTTCATTTGTAAAATGAGATTGG + Intergenic
1073241882 10:102064720-102064742 CCTTATCTGTAAAAGGGACTAGG + Intergenic
1073300486 10:102468270-102468292 CCTCTTCTGCAAAAGGTAAAAGG - Intronic
1073608323 10:104918284-104918306 TCTCATCTGTAAAATGTTGTTGG - Intronic
1074102666 10:110365728-110365750 CCTCATCTGTAAAATGGGAATGG + Intergenic
1074297817 10:112207305-112207327 CCTTATCTGTAGAATGTGTTAGG - Intronic
1074522069 10:114235146-114235168 CCTGACCTATAAAGGGTGATGGG - Intergenic
1074881587 10:117663573-117663595 CCCCATCTGGAAAAGGTGAATGG + Intergenic
1074944284 10:118266149-118266171 CCTCATCTGTAAAATGGCAAAGG + Intergenic
1075025884 10:118982725-118982747 CCTCATCTGCAAAATGGGAGAGG - Intergenic
1075739087 10:124682511-124682533 TCTCATCTGTAAAATGAGGTTGG - Intronic
1076111261 10:127861446-127861468 CCTCATCTGTAAAATGGAGTGGG - Intergenic
1077540077 11:3142518-3142540 CCTCATCTGTAAAAAGGGAGGGG - Intronic
1078107476 11:8367700-8367722 CCTCATCTGTAAAATAGGAATGG - Intergenic
1078422839 11:11226281-11226303 CCTCAGCTGTAAAATGGGTTTGG + Intergenic
1078433340 11:11304161-11304183 CCTCAGCAGTAAAAGTTTATGGG - Intronic
1078893446 11:15577944-15577966 CCTCATCTGTGAATGCTTATAGG - Intergenic
1078941430 11:16010699-16010721 GCCCATCTGTGAAAGGTAATTGG + Intronic
1079327776 11:19509158-19509180 CCTCTTCTGTAAAATGGGGTTGG + Intronic
1080036337 11:27715791-27715813 CCTCATCTGTAAAAGGTGATTGG + Intronic
1080085498 11:28276824-28276846 CCTGTTCAGTAAATGGTGATGGG + Intronic
1080181634 11:29432806-29432828 TCTCATCTGTAAAATGAGCTAGG + Intergenic
1080584841 11:33672423-33672445 CCTCCTTGGTAACAGGTGATTGG - Exonic
1080849006 11:36051442-36051464 CCACATCTGTAAAATGAGATAGG + Intronic
1081354583 11:42096501-42096523 CCTCCTCTGTAAAATGAGGTGGG + Intergenic
1081960643 11:47134110-47134132 CCTCATCTGTGAAATGGGACTGG + Intronic
1081994223 11:47353123-47353145 CCTCATCTGTAAAGCGGGGTGGG + Intergenic
1082855144 11:57799312-57799334 CCTCATTAGTAAAGAGTGATTGG + Intronic
1083186794 11:61022328-61022350 CCTCACCTGTAAAATGAGAGTGG - Intergenic
1083276166 11:61598219-61598241 CCTCATCTGTCAAATGGGGTGGG - Intergenic
1083767286 11:64847674-64847696 CCTTGTCTGTAAAAGGGGGTTGG + Intergenic
1083924993 11:65800694-65800716 CCTCATCTATAAAATGAGGTGGG + Intergenic
1085260793 11:75203593-75203615 CCTCATCTATAAAAGGAGGGGGG - Intronic
1085686332 11:78625172-78625194 CCTCTTCAGTAAATGGTGCTGGG - Intergenic
1085737769 11:79054179-79054201 CCTCCTATGTAAATGGTCATTGG - Intronic
1085947367 11:81287525-81287547 CCTCATTTGGAAAATGAGATTGG + Intergenic
1086041266 11:82482302-82482324 CCTATTCAGTAAAAGGTGCTGGG - Intergenic
1086165721 11:83775449-83775471 CCTCATCTGTAAAATGAGTAAGG + Intronic
1086424595 11:86671754-86671776 CCTCATCTCAACAAGGTAATGGG - Exonic
1086911098 11:92473701-92473723 CCTCTTCTGTACATGGTGATTGG - Intronic
1087155313 11:94896086-94896108 CCTCATCTGTAAATGATGGGTGG - Intergenic
1087442264 11:98201628-98201650 CCTAATCAGTAAATGGTGCTGGG - Intergenic
1087769518 11:102192614-102192636 ACTCATCTGTAAAATGTGACTGG + Intronic
1088057176 11:105598481-105598503 CATAATCTGGAAAAGGTGAAAGG + Intergenic
1088205003 11:107382450-107382472 CCTCAGCTGTAAGATGTGAAAGG + Intronic
1088808344 11:113371812-113371834 CCTTGTCTGTAAAAGGCAATAGG + Intronic
1088982915 11:114879937-114879959 CCTCATCTATAAAATGGGACTGG + Intergenic
1089175633 11:116547073-116547095 CCTCATTTATAACAGGGGATGGG + Intergenic
1089408351 11:118217727-118217749 CCTCATCTGTAAAACCTCATGGG - Intronic
1089637437 11:119824410-119824432 CCTCATCTGTAAAATGAGAATGG - Intergenic
1089775986 11:120836294-120836316 CCTCAGCTGTAAAATGGGGTTGG + Intronic
1090429734 11:126635716-126635738 CCTTATCTGTAAAATGTGGCTGG + Intronic
1090755142 11:129783954-129783976 CCTCAACTGTTAAAGGAAATGGG + Intergenic
1091320167 11:134643721-134643743 CCTCCTCTGTAAAATGAGAATGG + Intergenic
1091585351 12:1812849-1812871 CCTCATCTGTGAAACGGGAACGG + Intronic
1092006272 12:5073127-5073149 CTTCATCTATGAAATGTGATTGG - Intergenic
1094069816 12:26400874-26400896 CCTCATCTGTAAAATGGGGAGGG + Intronic
1094229609 12:28087835-28087857 CCTCATCCGTTAAATGTGTTTGG - Intergenic
1095552912 12:43465358-43465380 CCTCATCTGTAAATTGAGAGTGG + Intronic
1095803616 12:46294302-46294324 CCTCTTCAATAAAAGGTGATGGG + Intergenic
1096792471 12:54053610-54053632 CCTCCCCTGCAAAAGGAGATGGG - Intronic
1097442681 12:59630447-59630469 CCTCATCAGTAAAATGTGTCTGG + Intronic
1098384984 12:69909103-69909125 CATGATATGTTAAAGGTGATTGG + Intronic
1098604776 12:72376911-72376933 CCTTATCTGTAAAATGGGATTGG + Intronic
1099600848 12:84735513-84735535 CCTAATCAGTAAATGGTGCTTGG + Intergenic
1099653823 12:85463905-85463927 CATCACATTTAAAAGGTGATAGG - Intergenic
1099917273 12:88910299-88910321 CATCATCAGTAAATGGTGCTGGG - Intergenic
1100744349 12:97629108-97629130 CCTCATTTGCAAAAGGAGACTGG - Intergenic
1101347783 12:103902402-103902424 TCTCATCTGTAAAATGAGAATGG - Intergenic
1101411298 12:104470718-104470740 CCTCACCTGTATAATGGGATTGG - Intronic
1101728336 12:107406112-107406134 CCTCATCTGTAAAACAGGCTGGG + Intronic
1101827447 12:108231507-108231529 CCTCATCTGTAAAATGGGTTGGG - Intronic
1101827537 12:108232235-108232257 TCTCATCTGTAAAATGGGTTGGG + Intronic
1101889639 12:108701663-108701685 TCTTATCTGTAAAAGGGGAAGGG - Intronic
1102016652 12:109652435-109652457 CCTCATCTGTAAAATGGGGCGGG + Intergenic
1102774564 12:115507326-115507348 CCTCATCTGTAAAATAGGATAGG - Intergenic
1103236075 12:119373686-119373708 CCTTATCTGTAAAATGAGATGGG + Intronic
1103956078 12:124577615-124577637 CCTCATCTGTAAAATGGGGCTGG + Intergenic
1104322383 12:127763832-127763854 ACTGATCTGTAAAATGTTATCGG + Intergenic
1107583337 13:41816228-41816250 TCTCATCTGTAAAATGGGAACGG - Intronic
1107811058 13:44200069-44200091 CCTCCTCTGTAGAATGTGAGTGG - Intergenic
1107869488 13:44734193-44734215 CCTCATCTGTTTCAGGTTATGGG + Intergenic
1109029464 13:57174601-57174623 CCCTTTCTGTACAAGGTGATTGG + Intergenic
1109376803 13:61505819-61505841 CCTCTTCAGTAAATGGTGCTAGG + Intergenic
1109394310 13:61735285-61735307 TCTCTTCTGTAAATGGTGCTAGG - Intergenic
1109950350 13:69493989-69494011 ACTCACCTGTAAAAGGCCATAGG + Intergenic
1110483092 13:76006049-76006071 CCCAATCTGTCAAAGGTGACAGG - Intergenic
1110586040 13:77194669-77194691 CCTCATCCATAAAAGGTGGGTGG + Intronic
1113556278 13:111238315-111238337 TCTCATTTGTAAAATGAGATTGG + Intronic
1114667759 14:24390301-24390323 CCTCACCTTTAAAAAGCGATAGG - Intergenic
1117196007 14:53340777-53340799 CCTCATCTGTAAAACGGGGGTGG + Intergenic
1119548365 14:75489966-75489988 CTTCATCTGTAAAATGTGGGGGG + Intergenic
1120256526 14:82126727-82126749 CTTCATCTGTATAATGTGAATGG - Intergenic
1121075126 14:91061091-91061113 CCTCCTCTGTCCACGGTGATTGG - Intronic
1121248468 14:92482164-92482186 CCTCATCTGTTAAATGAGAAAGG - Intronic
1121249902 14:92491785-92491807 ACACATCTGTTAAAGGTGAGAGG - Intronic
1121314036 14:92950563-92950585 CCTCATCTGTAAAACGGGAAGGG - Intronic
1122138518 14:99648328-99648350 CCTCATCTGTGGAAGGGGAAAGG - Intronic
1122267987 14:100555546-100555568 CCTCATCTGGAAAACGGGGTGGG - Intronic
1126628846 15:50713022-50713044 CCTCATCCATAAAATGAGATTGG - Intronic
1127539950 15:59927502-59927524 TCTCATCTGTAAAGGTAGATAGG - Intergenic
1128148664 15:65347371-65347393 TCTCATCTGTAAAATGGGAGTGG + Intronic
1128342836 15:66834799-66834821 CCTCACCTGTAAAAGTGGAGGGG - Intergenic
1129384591 15:75188927-75188949 CCCCATCTGTAACAGGCAATCGG - Intergenic
1129712677 15:77828575-77828597 CCTCATCTATAAAACGGGAGGGG - Intergenic
1131126618 15:89863698-89863720 CCACATCTGCTTAAGGTGATGGG + Intronic
1131719870 15:95156248-95156270 TCTCATCTGTCCAAGGAGATGGG + Intergenic
1132895431 16:2226959-2226981 CCTCATCTGTAAAATGGGCTGGG - Intronic
1133771029 16:8867327-8867349 CCTCATCTGTCAAAGGGGACAGG + Intronic
1133872795 16:9705227-9705249 CCTCATCTGTAAAAGGCGGATGG - Intergenic
1133921751 16:10159622-10159644 CCTCATCTGTAAAATGGGATTGG - Intronic
1134025867 16:10953284-10953306 CCTTTTCTGTAAATGGTGCTGGG + Intronic
1134106790 16:11491417-11491439 CCTCATCTGTAAAATAGGATGGG - Intronic
1134213596 16:12298500-12298522 TCTCATCTGTAAAATGGGAATGG + Intronic
1135169100 16:20167219-20167241 CCCCATCTGTAAAATGGGGTAGG + Intergenic
1135458732 16:22622625-22622647 CCTCATCTGTAAAATGGCAAAGG - Intergenic
1136098649 16:27977131-27977153 TCTCATCTGTAAAATGGGAATGG - Intronic
1136112443 16:28073058-28073080 CCTCATCTGTCAAAGAAGACTGG - Intergenic
1136145689 16:28315171-28315193 TCTCATCTGTAAATGGAGAGAGG - Intronic
1136224133 16:28847138-28847160 CCTCATCTGCAAAATTAGATGGG - Intronic
1136277683 16:29188549-29188571 CCTCCTCAGCAAATGGTGATGGG - Intergenic
1136372317 16:29844140-29844162 CCTCATCTGTAAAATGGGGGTGG + Intronic
1136454950 16:30375148-30375170 TCTCATTTGTAAAATGGGATGGG - Intronic
1136500524 16:30667779-30667801 CCTCATCTGTAAAATGAGTAGGG + Intronic
1136649063 16:31650537-31650559 CGTCATCTATAAAAAGTGAAAGG - Intergenic
1136997619 16:35201572-35201594 CCTCATCTGGGAAGTGTGATGGG - Intergenic
1137430635 16:48415528-48415550 CCTCATCTATAAAATGGGCTGGG + Intronic
1137727959 16:50669794-50669816 CCTCAACTGAAAAATGGGATAGG + Intronic
1138121679 16:54405364-54405386 CCTCATCTGTAGAATGGGAAGGG + Intergenic
1138139833 16:54558644-54558666 CCTCATCTGTAAAATGGGGATGG + Intergenic
1138139987 16:54559801-54559823 CCTCATCTGTAAAATGGGGATGG - Intergenic
1138548539 16:57734746-57734768 CCTCATCTGTAAATGGGAACAGG + Intergenic
1138576379 16:57909897-57909919 CCTCAGCTGTAAAATGGGAATGG + Intronic
1138741821 16:59319756-59319778 CCTCATCTGTACAATGGGAATGG + Intergenic
1141544664 16:84757032-84757054 TCTCATCTGTAAAATGGGGTTGG + Intronic
1142082058 16:88154591-88154613 CCTCCTCAGCAAATGGTGATGGG - Intergenic
1142117479 16:88367310-88367332 CCTCATCTGTAAAGTGGGCTTGG - Intergenic
1142233712 16:88911597-88911619 TCTCATCTGTAAAATGGGAATGG + Intronic
1143368170 17:6421976-6421998 CCCCATCTGTACAAGGGGTTGGG + Intronic
1143392374 17:6567297-6567319 CCTTATCTGTAAAATGGGAATGG - Intergenic
1143420272 17:6785252-6785274 CCTCTTCAGTAAATGGTGCTAGG + Intronic
1144036302 17:11369004-11369026 CTTCATCTGTAAAATGGGAATGG - Intronic
1144378531 17:14669708-14669730 CCTCATCTGTAAAATGTAGATGG - Intergenic
1144754534 17:17671173-17671195 CCTCATCTGTAAAATGGGGCTGG + Intergenic
1144888355 17:18478835-18478857 CCTCATCTGTAAAAGTGGCCGGG + Intronic
1145143851 17:20465467-20465489 CCTCATCTGTAAAAGTGGCCGGG - Intronic
1145792019 17:27633226-27633248 CCTCATCTGTAAAAGTGGCCGGG + Intronic
1146091893 17:29887557-29887579 CCTCATCTGTAAAATGAGGATGG + Intronic
1146134528 17:30307282-30307304 CCTCATCTATAAAATGGGAATGG - Intergenic
1146582503 17:34051428-34051450 CCTCACCTGTAAAATTGGATTGG + Intronic
1146594930 17:34160149-34160171 TCTCATCTGTAAAATGGGCTTGG - Intronic
1146603459 17:34238031-34238053 TCTCATCTGCAAAAGGTTAGGGG + Intergenic
1146973777 17:37093855-37093877 CCTCATCTGTAAAATGGGGGTGG - Intronic
1147887587 17:43694928-43694950 CTTCATCTGTAAAATAGGATAGG + Intergenic
1148427901 17:47616123-47616145 CCCCATGTGTAAAATGAGATGGG - Intronic
1148539681 17:48470342-48470364 CTTCATCTGTGAAAAGTTATAGG + Intergenic
1148719064 17:49737730-49737752 TGTCAGCTGTAAAAGGGGATAGG + Intronic
1148741135 17:49893459-49893481 CCTCCTCTGTACAAGGTGCTGGG - Intergenic
1148804767 17:50258655-50258677 CCTCACCTGTAAAATGGGATGGG - Intergenic
1148867083 17:50634439-50634461 CCTCATCTGTAAAATGGGAAGGG - Intergenic
1149194907 17:54108029-54108051 CCCCATCTGTGAAATGAGATGGG - Intergenic
1149346475 17:55741568-55741590 CCTCATCTGTAAAATGAAAGTGG + Intergenic
1151306572 17:73266512-73266534 GCTCATCTGTAAAAGGGGTGAGG - Intergenic
1151344204 17:73491849-73491871 CGCCATCTGGAAAAGGTGGTCGG + Intronic
1152690236 17:81714664-81714686 CCTCATCTGCAGAAGGAGAATGG + Intronic
1153599821 18:6769279-6769301 CCTTATGTGTGAAAGATGATTGG - Intronic
1153610024 18:6874883-6874905 CCTCATCAGTAAAAGGGCAGTGG - Intronic
1155546020 18:26916439-26916461 GATCATCTGTAAAAAGTAATTGG + Exonic
1157084057 18:44559523-44559545 CCTCATTTGTGAAATGAGATCGG - Intergenic
1157198834 18:45642003-45642025 CCTCATCTGTAAAATGGGCCAGG - Intronic
1157286266 18:46379449-46379471 CCTCATCTGTAAAATGGACTCGG - Intronic
1157495955 18:48157711-48157733 CCTCATCTGTAAAAGCTGAGTGG + Intronic
1157770250 18:50339366-50339388 CATCCTCTGTGGAAGGTGATTGG - Intergenic
1158479088 18:57804459-57804481 CCTCATTTGTAAAATGAGATTGG + Intergenic
1159095155 18:63893861-63893883 CCTCATCTGTAAAATGAGTACGG - Intronic
1159878050 18:73832412-73832434 CCTCCTCTGTATATGGTCATGGG + Intergenic
1161249159 19:3271135-3271157 CCTCATCTGCCCAAGGTGCTGGG + Intronic
1161505334 19:4640577-4640599 CCTCATCTGTAAAACAGGAGTGG + Intronic
1162364080 19:10237413-10237435 CCTCTTCTTTAAAATGGGATTGG - Intergenic
1162365039 19:10243440-10243462 CTTCATCTTTAAAATGGGATTGG - Intergenic
1165394542 19:35557263-35557285 CCTCATCTGTAAGATGAGAATGG - Intronic
1166164659 19:40978867-40978889 TCTCATCTGTAAAATGAGAATGG - Intergenic
1167006891 19:46782159-46782181 CCTCATCTATAAAATGGGAACGG - Intronic
1167405108 19:49301603-49301625 CCTCAGCTGTGAAAGCTGCTTGG - Intronic
1168490498 19:56804840-56804862 CCTCATCTGTAAAATGGGGCTGG - Intronic
926348331 2:11970426-11970448 CCTCTTCTATAAATGGTGCTGGG - Intergenic
926920650 2:17936837-17936859 CCTCATCTATAAAATGGGAATGG - Intronic
927154723 2:20214946-20214968 TCTCATCTGTAAAATGTGCATGG - Intronic
927590719 2:24355491-24355513 CCTATTCTGTAAATGGTGCTGGG + Intronic
928253972 2:29706118-29706140 CCTCATCTGTAAAATGGAGTGGG + Intronic
929474866 2:42235945-42235967 TCTCTTCTGTAAAAGTAGATGGG - Intronic
931188096 2:59973284-59973306 CCTCATCTGTAAAATGGGGATGG - Intergenic
931486150 2:62694708-62694730 CCTCATCTGTAAAATGGGAATGG - Intronic
931523498 2:63126419-63126441 CTTCATCTGTAAAATGAGAATGG - Intronic
932375686 2:71233629-71233651 CCTCAGCTTACAAAGGTGATGGG + Intergenic
933287177 2:80397348-80397370 CCTCATCTGTAAAATGAGCATGG - Intronic
933411263 2:81928199-81928221 CCTCATTTGTAAAATATGAAAGG - Intergenic
933447609 2:82402243-82402265 CCCCTTCAGTAAAAGGTGCTGGG - Intergenic
933617318 2:84495839-84495861 TCTCATCTTTGAGAGGTGATTGG + Intergenic
934676448 2:96253067-96253089 ACTCATATTTAAAAGGTGAAGGG + Exonic
935080281 2:99786247-99786269 CCTCATCTGTAAATGGGGACTGG + Intronic
935426886 2:102928838-102928860 CCTCATGAGTAAAAAGAGATAGG - Intergenic
937096718 2:119240476-119240498 ACTCATGTCTGAAAGGTGATCGG + Intronic
937215501 2:120310262-120310284 CCTCATCTGTAAAATGAGGGGGG + Intergenic
937723391 2:125129728-125129750 CCCCATCAGTAAATGGTGCTGGG + Intergenic
938615362 2:132992120-132992142 CCTTATCTGTAAAATGGGAAAGG - Intronic
938883844 2:135622581-135622603 CATCATGTGTAAAAGGGAATGGG + Intronic
939419715 2:141950915-141950937 CCACATCTGTAAAATTTGCTTGG + Intronic
939620493 2:144413025-144413047 CCTCATCTGTAAAATGAGCCAGG + Intronic
939679510 2:145112904-145112926 CTTCATTTGTAAAATGTGGTTGG + Intergenic
941754793 2:169173562-169173584 CCTCATCTGTAAAATGGAATTGG + Intronic
942643680 2:178087991-178088013 CCTCATCTATAAAACGTGAGGGG - Intronic
943354755 2:186838953-186838975 CATCACCTGCAAAAGGTGACAGG + Exonic
943500914 2:188688640-188688662 CCTCTTCAGTAAATGGTGCTGGG - Intergenic
944977128 2:205066591-205066613 CTTCATCTGTAAAATGAGAAAGG + Intronic
946413039 2:219525000-219525022 GCTCATCTGTAAAAGGGGAATGG - Intronic
946492585 2:220164284-220164306 CCTCATCTGTAAAATGGCATTGG + Intergenic
948165759 2:235861263-235861285 CCTCTTCTTTAAATGGTAATTGG + Intronic
1168797274 20:620039-620061 CCTCATCTGTAAAATGAACTTGG - Intergenic
1168927061 20:1590527-1590549 CCTCGCCTGTAAAAGGAGGTAGG - Intronic
1168939475 20:1696473-1696495 TCCCATCTGTAAAAGGGCATTGG + Intergenic
1168966223 20:1899804-1899826 GCTCATCTGTAAAAGAGGAATGG + Intronic
1172114312 20:32564668-32564690 CTTCATCTGTAAAATGGGCTAGG + Intronic
1172116802 20:32577879-32577901 CCTCATCTGGAAAATGGGAATGG - Intronic
1172298332 20:33829998-33830020 CCTCATTTGTAAAATGGGAGTGG - Intronic
1172807644 20:37624116-37624138 TCTCATCTGCAAAATGGGATTGG - Intergenic
1172890633 20:38261136-38261158 CTTCATCTGTAAAATGGGGTGGG + Intronic
1173297356 20:41771608-41771630 CCTTATCTGTAAAAGGTCCCTGG + Intergenic
1173348770 20:42225395-42225417 TCTCATCTGTAAAATGGGAATGG - Intronic
1174116133 20:48227651-48227673 CCTCATCTGTAAGTGGTGGGTGG - Intergenic
1174520986 20:51130474-51130496 CCTCATCTGAAGAAGGGGGTCGG + Intergenic
1174924463 20:54742400-54742422 TCTCATCTATAAAAGGAAATGGG - Intergenic
1175226372 20:57446474-57446496 CCTCATTTGTAACATGTGAATGG + Intergenic
1175624968 20:60482406-60482428 GCTCATCTGTAAGAGGTGGACGG - Intergenic
1175675091 20:60939534-60939556 CCTGATCTTTAGCAGGTGATTGG + Intergenic
1175989133 20:62778854-62778876 CCCCATCTGTAAATGGAGACAGG - Intergenic
1178060410 21:28847852-28847874 TCTCTTCTGTAAATGGTGCTGGG - Intergenic
1178134194 21:29608240-29608262 GCTCATGTGTATAAGGTAATGGG + Intronic
1178294792 21:31400613-31400635 CCTTATCTGTAAAATGGGGTAGG - Intronic
1179967600 21:44816499-44816521 CCTCATCTGTAAAGGGAGGGTGG + Intronic
1179994863 21:44969360-44969382 TCTCATCTGAAAAATGTGCTTGG + Intronic
1181723142 22:24791529-24791551 TCCCATCTGTAAAATGGGATGGG - Intergenic
1181787686 22:25238745-25238767 CCACATCTGTACCAGGAGATAGG + Intergenic
1181802777 22:25358261-25358283 CCTCATCTGTGAAAGAGGAAGGG - Intronic
1181819420 22:25463780-25463802 CCACATCTGTACCAGGAGATAGG + Intergenic
1181912282 22:26248243-26248265 CTTCATCTGTAAAATGTGAATGG + Intronic
1181956086 22:26589189-26589211 CCCCATCTGTAAAAGGGGAAGGG + Intronic
1182047309 22:27285413-27285435 CCTCATCTATAAAATGGGAAGGG - Intergenic
1182052093 22:27321140-27321162 CCTCATCTGTAAAATGGAAATGG + Intergenic
1182247554 22:28971615-28971637 CCTCATCTGTAAAATAAGAATGG - Intronic
1182412058 22:30195654-30195676 CCTCATCTACAAAATGAGATTGG - Intergenic
1182413481 22:30206121-30206143 CCTCATCTGTAAATGGAGGCGGG - Intergenic
1183080914 22:35455833-35455855 CTTCATCTGTAAAAGCCGAATGG - Intergenic
1183255156 22:36757211-36757233 CCTCATTTGTAAAAGGGGGATGG + Intergenic
1183293403 22:37016520-37016542 CCTCATCTGTAAAATGGGTGAGG + Intronic
1183684831 22:39355664-39355686 CCTCATCTGTAACATGGGATTGG + Intronic
1184604360 22:45563652-45563674 CCACATCTGTAAAACGAGAGGGG - Intronic
1184809275 22:46818481-46818503 CCTCTTCAGTAAATGGTGCTGGG - Intronic
949510041 3:4759540-4759562 CCTCATCTGTGAAATGTGGAAGG + Intronic
949537280 3:5005725-5005747 CCCCATCTCTAAAATGGGATTGG + Intergenic
949878585 3:8643849-8643871 TCTCATCTATAAAACGAGATTGG - Intronic
950458464 3:13106484-13106506 CCTCATCTGTACAATTTCATGGG - Intergenic
950521382 3:13499949-13499971 CCTCATCTGTAAAATGGGGATGG + Intronic
950654971 3:14430919-14430941 CCTCATCTGTAAAATGGGCTTGG + Intronic
950669030 3:14514153-14514175 CCTCATCTGTAAAATGGGGCTGG + Intronic
952844837 3:37679556-37679578 CTTCATCTGTAAAATGTGAAGGG + Intronic
953227260 3:41032205-41032227 CCTCATCTGTAAAACGGGGTTGG - Intergenic
953741839 3:45545121-45545143 CCCTATCTGTAAAATGGGATGGG + Intronic
953928239 3:46993205-46993227 CCTCATCTGTAAAAACAGAGGGG - Intronic
954361115 3:50123356-50123378 CCTCAAATGTCAAGGGTGATGGG - Intergenic
954619272 3:51986398-51986420 CCTCATCTGTAAAAGCAGCAGGG - Exonic
954623127 3:52006865-52006887 CCTCATCTGTAAAAGAGGTCTGG + Intergenic
954845177 3:53549495-53549517 CCTCAGCTGTAAAATGAGGTAGG + Intronic
956206612 3:66761554-66761576 CCTCATATGTAAAATGAGAAGGG + Intergenic
956733761 3:72219957-72219979 CCTCATCTGTAAAATGGGGCAGG + Intergenic
957103593 3:75858533-75858555 ACTCATCTGTAATGGTTGATGGG - Intergenic
958159098 3:89793610-89793632 CCTTATCAATAAAATGTGATAGG - Intergenic
958696475 3:97534143-97534165 CCACATCTGTAAAATGGGACAGG + Intronic
958902132 3:99899819-99899841 TCTCATCTGTAAAATGGGAATGG + Intronic
959021794 3:101195529-101195551 CCTCATCTGTAAATGGGGGCTGG - Intergenic
960122130 3:113957648-113957670 CTTCATTTGTAAAAGCTGAAGGG - Intronic
960389164 3:117055681-117055703 AATCATCTTTAAAAGGTAATTGG - Intronic
960574498 3:119216861-119216883 CCTCATCTGTAAAATGGCAATGG + Intronic
960876892 3:122305426-122305448 CAACATCTGTCATAGGTGATGGG + Intergenic
961072404 3:123945872-123945894 CCTCATCAGTAAAATGGGAGTGG + Intronic
961535496 3:127568137-127568159 CCTCATCTGTAAAATGGGATAGG + Intergenic
961622606 3:128236400-128236422 CCTCATCTGTAAATGGCGGGGGG + Intronic
962454890 3:135555995-135556017 CCTCAGCTGGAAAAGGGCATTGG + Intergenic
962807439 3:138937480-138937502 CCTCATCTGTAAACTTTGAAAGG + Intergenic
963841843 3:150115858-150115880 CCTCATATATAAAATGGGATAGG - Intergenic
964174174 3:153805390-153805412 CTTCATCTGTAAAGTGGGATAGG + Intergenic
964339175 3:155690235-155690257 TCTCATCTATAAAAGGAGAGTGG + Intronic
964834969 3:160928353-160928375 CCTCATCTGAACACAGTGATTGG + Intronic
965721251 3:171664969-171664991 CCACCTCTGTAAAAAGTTATAGG + Intronic
965741755 3:171882651-171882673 CCTCATCTGTTACAGGTTATTGG - Intronic
966733833 3:183173029-183173051 CCAGATCTGTAAAATCTGATGGG - Intergenic
966777464 3:183555563-183555585 GCTCATCTGTAGAAGGTGCCAGG + Exonic
966964343 3:184974789-184974811 CCTCTTCAGTAAATGGTGTTGGG - Intronic
967260817 3:187640197-187640219 CCTCATCTGTAAAATGGTAGTGG - Intergenic
967634147 3:191780910-191780932 CCTCATCTGTAAATTTTGAAAGG + Intergenic
969296964 4:6275946-6275968 CCTCATCTGAAAATGGGGACGGG - Intronic
969369775 4:6724232-6724254 CCTCATCTGGAGACTGTGATGGG + Intergenic
969524327 4:7696494-7696516 CCTCATCTGTAACATGAGGTTGG + Intronic
970108129 4:12608220-12608242 CCTCATCTGTAAAATGGAATAGG - Intergenic
970300489 4:14676561-14676583 CGTCATCTGTATATGGTGACAGG - Intergenic
970526834 4:16941533-16941555 TCTCATTTGTAAAAGATAATAGG - Intergenic
970560355 4:17276170-17276192 CCTCGTCTGTAAAATGGGAAGGG + Intergenic
971749371 4:30626658-30626680 CTTCATCTGGATAAGGTAATTGG + Intergenic
974927443 4:68317873-68317895 CCTCATCTGTAAAATTCCATGGG - Intronic
975579331 4:75892476-75892498 CCTCATCTGGAAAAGGGGCGGGG + Intronic
976071565 4:81246216-81246238 CCTCATCTGTAAAATGAGTGTGG + Intergenic
976116145 4:81729413-81729435 CCTCATCAATAAATGGTGCTGGG + Intronic
976218693 4:82738871-82738893 CCTCATCTGTAAAATGGGGTTGG - Intronic
976358320 4:84147103-84147125 CCACAGCTGTAAAATGAGATTGG - Intergenic
976547907 4:86359190-86359212 CCATATCTGAAAAATGTGATGGG - Intronic
976774723 4:88695784-88695806 CCTCATCTACAAAAGGGAATAGG - Intronic
977638249 4:99325683-99325705 CTTCATCTGTAAAATGTGCATGG - Intergenic
978844423 4:113255115-113255137 CCTCAACTGTAAAAGTTGTGAGG + Intronic
979624674 4:122831101-122831123 CCTCTTCTGTAAAAAGAGATGGG - Intronic
979735486 4:124077507-124077529 CCTCTTCAGTAAATGGTGCTGGG + Intergenic
980254097 4:130353735-130353757 CCTCATCTGTAAAATGAAAGTGG + Intergenic
980314476 4:131178760-131178782 CCTCATCTATAAAATTGGATAGG + Intergenic
980315429 4:131193480-131193502 CCTAATCTGTAAAATATGATTGG + Intergenic
981013496 4:139950506-139950528 TCTCCTGTGAAAAAGGTGATAGG - Intronic
982297725 4:153847088-153847110 CTACATCTATAAAAGGGGATCGG - Intergenic
983915433 4:173286805-173286827 CCTCAACTGTTAAAGGAAATGGG + Intronic
985333333 4:188864925-188864947 CTTGATCTGTAAGAGGTGAGAGG + Intergenic
986791933 5:11170059-11170081 CCTCATCTGTAAAATGGACTTGG - Intronic
989127643 5:38072612-38072634 CTTCATCTGTAAAAGGGGGAGGG + Intergenic
990510629 5:56486400-56486422 CCTCATCTGTAAAATGGGGAGGG - Intergenic
991426142 5:66494291-66494313 ACTCATCTGTAAGCGGGGATAGG - Intergenic
991513329 5:67404908-67404930 CCTCATCTGTAAAATGTAGATGG + Intergenic
991972763 5:72156893-72156915 CCTCATCTGTAAAAGGGCAGTGG - Intronic
991990795 5:72337109-72337131 TCTCATTTGTAAAATGAGATAGG - Intronic
992401143 5:76412872-76412894 CCTCATCTGTAAAATGTAAGTGG + Intronic
992743003 5:79792616-79792638 TCTCATCTGTTAAAGGGGAGAGG + Intronic
992940062 5:81751903-81751925 CCTCCTCTGTAAGAGGTGAGCGG + Intergenic
995307263 5:110667689-110667711 CCTCACCTGTAAAATGAGAATGG + Intronic
996155139 5:120090166-120090188 TCTCACCTGTAAAATGTGGTAGG + Intergenic
996688765 5:126314480-126314502 TCTCAGCTGAAAAAAGTGATCGG + Intergenic
996824442 5:127665403-127665425 CCTCATCTGTAAAATGGGCATGG + Intergenic
997398370 5:133582344-133582366 CCTCATCTGCAAAATGAGGTAGG + Intronic
997622764 5:135309636-135309658 CCTCATCTGTGAAATGTGAGAGG + Intronic
998246685 5:140513465-140513487 CTTGATCTGGAAAAGGTGAGTGG + Exonic
998458054 5:142289001-142289023 CCTCATCTCTAAAATGAGCTTGG + Intergenic
999095850 5:148977590-148977612 CCTCATCTGTAAAATGGGGTTGG - Intronic
999111744 5:149127348-149127370 CCTCATCTCTAAAATGGGTTTGG - Intergenic
999141150 5:149362950-149362972 CTCCATCTGTAAAATGAGATTGG - Intronic
999861278 5:155649299-155649321 CCTCATCTGTAAAATGGGGATGG + Intergenic
1001489376 5:172144852-172144874 CCTCATCTGTAAAAGGGGGTGGG - Intronic
1001752091 5:174139250-174139272 TCTCATCTGTAAAATGGGAATGG + Intronic
1002045614 5:176540248-176540270 CCTCATCTGTAAAATGAGGCTGG - Intergenic
1002053538 5:176585487-176585509 CCTCATCTATAAAATTGGATAGG - Intronic
1002093616 5:176818284-176818306 CCTCATCTGTAAAACGGGAATGG - Intronic
1002603899 5:180370726-180370748 CCTCATCTGTAAAACGGGGCTGG + Intergenic
1002718701 5:181245286-181245308 TCTCATCTGTGAAATGAGATTGG + Intronic
1003252124 6:4438609-4438631 CCTCTTCAATAAATGGTGATGGG + Intergenic
1004007152 6:11647517-11647539 CCTCATCTGTAAAACGAGGAGGG - Intergenic
1004178196 6:13359061-13359083 GCGCTTCTTTAAAAGGTGATGGG - Exonic
1004326262 6:14676471-14676493 CCTCACCTGTAAAATGAGAAGGG + Intergenic
1004825831 6:19420058-19420080 CCTAATCAGTAAATGGTGTTAGG - Intergenic
1006808926 6:36807345-36807367 CCTCCTCTGTAAAATGGGAATGG + Intronic
1006830734 6:36966690-36966712 CCTCATCTGAGAAAGGAGATTGG - Intergenic
1007107959 6:39296272-39296294 CCTCACCTGTAAAAGGGGGCTGG - Intergenic
1007454683 6:41967457-41967479 CTTCATCTATAAAAGGAGCTGGG + Intronic
1007918019 6:45579262-45579284 CCTCATCTGTAAAATGGGGATGG - Intronic
1007940867 6:45780213-45780235 CCTCATCTGCAAAAGGAGAGGGG - Intergenic
1008038448 6:46772229-46772251 CCTCATTTGTAATTGGTGATAGG + Intergenic
1008109815 6:47479228-47479250 TCTCAACTGCAAAAAGTGATAGG - Intronic
1010564783 6:77397035-77397057 CCTCAACTGTAAGATGTGTTAGG + Intergenic
1010705615 6:79105676-79105698 CCTCATCTGTAGCAGGTATTAGG + Intergenic
1011106967 6:83792844-83792866 CCTATTCTGTAAATGGTGCTTGG + Intergenic
1012102783 6:95112192-95112214 CCTCATCTATAAAGGATGAGGGG + Intergenic
1012141061 6:95627324-95627346 CCTATTCTGTAAATGGTGCTGGG + Intergenic
1012775652 6:103490875-103490897 CCTCATATGCAAAAGGGGAGAGG + Intergenic
1012862141 6:104572521-104572543 CCTCATCTGTAAAATGGGTATGG + Intergenic
1013290089 6:108712370-108712392 CCTCATCTGTAAAATGGGGGAGG + Intergenic
1014708526 6:124778899-124778921 CCTCATTTGTAAATGTTCATCGG - Intronic
1014756501 6:125307204-125307226 ACACATCTGTTAATGGTGATTGG - Intergenic
1015178208 6:130334440-130334462 CCTCATCTGTAAAATGAAAGAGG - Intronic
1016175398 6:141072797-141072819 CCTCAGCTGCCAAAAGTGATGGG - Intergenic
1016246474 6:141987098-141987120 CCACAGCTCTAAAATGTGATGGG - Intergenic
1017799540 6:157880871-157880893 CCTCATCTGTAAAACCTCATGGG + Intronic
1018317843 6:162574928-162574950 CCTAATCTATAAAATGTGAAAGG - Intronic
1018555121 6:165041306-165041328 TCTCTTCTGTAAATGGTGCTGGG - Intergenic
1019081042 6:169429942-169429964 ACTCATCTGGAAAACGTGTTTGG - Intergenic
1019567459 7:1691515-1691537 CCTCATCTGTAAAATGGGCAGGG + Intronic
1019657476 7:2203728-2203750 CCCCAATTTTAAAAGGTGATGGG + Intronic
1019896822 7:3989451-3989473 CCTCATCTGGAATAAATGATGGG - Intronic
1020129623 7:5552346-5552368 TCTCATCTGTAAAATGGGGTGGG + Intronic
1021309609 7:19077512-19077534 CCTCTTCAGTAAACGGTGCTGGG + Intronic
1021982319 7:26066889-26066911 CCTCATCTGTAAAATGGGGATGG - Intergenic
1022283423 7:28933204-28933226 TCTCATCTGTGAAAGGGGTTAGG - Intergenic
1023272247 7:38476762-38476784 CCTCCTCTATAAAAGGAGATTGG - Intronic
1023419941 7:39968538-39968560 CCTCTTCAATAAATGGTGATGGG - Intronic
1023435892 7:40140274-40140296 CCTTTTCAGTAAAAGGTGCTGGG - Intronic
1023627285 7:42128845-42128867 CCTCATCTCTAAAATGGGAGTGG - Intronic
1024629679 7:51236705-51236727 CCTCACCTGTAAAGGGGAATGGG + Intronic
1024643697 7:51353961-51353983 CCTCTGCTGTATATGGTGATGGG - Intergenic
1026020105 7:66699388-66699410 TCTCATCTGTAAAATGGGAGTGG + Intronic
1026255498 7:68707708-68707730 TTTCATCTGTAAAACGAGATGGG + Intergenic
1027269545 7:76512249-76512271 CCTCATCTGTAAGAGCGGGTAGG - Intronic
1027320256 7:77006143-77006165 CCTCATCTGTAAGAGCGGGTAGG - Intergenic
1027414836 7:77963879-77963901 CCTCATCTGTAAAATGAGATAGG + Intergenic
1028301139 7:89202657-89202679 CCTCATCTGGAAAATGAGGTTGG - Intronic
1028573694 7:92321244-92321266 TCTCATCTTTAAAAAATGATAGG - Intronic
1028633846 7:92965224-92965246 CCTTATCTGTAAATGGTGTGGGG + Intergenic
1028710629 7:93903560-93903582 CCTCATCTGCAAAATGGAATAGG + Intronic
1028745700 7:94323991-94324013 CCTCATCTGCCAAAGGGGAAGGG - Intergenic
1028983239 7:96989847-96989869 CCTCAACTGGAAAAGGAGTTGGG + Intergenic
1029342419 7:99956016-99956038 CCTCATCTGTAACAGGAAAGAGG + Intergenic
1030115854 7:106061843-106061865 CCTCATCTGTATACTGGGATAGG - Intergenic
1030229211 7:107188081-107188103 CCTGATCTGAAAAATGGGATTGG + Intronic
1030676410 7:112390379-112390401 CCTCATCTGTAAAATGGGGATGG + Intergenic
1031085057 7:117294202-117294224 CCTCATCCTTAAAAGGCCATTGG + Intronic
1031805004 7:126297156-126297178 CCTATTCTGTAAATGGTGCTGGG + Intergenic
1033764655 7:144475119-144475141 CCTTTTCTGAAAAAGGTGATAGG - Intronic
1034544802 7:151782717-151782739 CCTCATCTGTAAAATGAGGATGG + Intronic
1035714205 8:1741409-1741431 CCTTAGCTGTAAAACGTGACAGG + Intergenic
1037526371 8:19728157-19728179 CCTCATCTGTAAAATCTCGTAGG + Intronic
1037744412 8:21631398-21631420 CCTCATTTGTAAAATGGGAATGG + Intergenic
1038352214 8:26787032-26787054 CCTCATCTGTAAGATGAGGTTGG - Intronic
1039329601 8:36522718-36522740 CTTCATCTGTTAAAGATGAACGG - Intergenic
1041661940 8:60409388-60409410 TCTCATTTGTAAAAGGTTGTTGG - Intergenic
1041748761 8:61236766-61236788 CCTCATTTGTAAAATGAGGTCGG - Intronic
1042202829 8:66298157-66298179 CCCCATGTGTAAAGGGAGATGGG + Intergenic
1042273483 8:66979284-66979306 CCTCTTCAATAAATGGTGATGGG - Intronic
1042892153 8:73624552-73624574 CCTCATCTGTAAAATGAAGTGGG - Intronic
1043111454 8:76188516-76188538 CCTCTTCTGAAAATGGTGACAGG + Intergenic
1043417608 8:80067557-80067579 CCTGATCTGTAAGTGGTGACAGG - Intronic
1044019573 8:87087833-87087855 CCTCATCTGTAAAATGAGAAAGG - Intronic
1044112851 8:88297774-88297796 CCTCATCTGTAAAATGAGTATGG + Intronic
1044545935 8:93459448-93459470 CCCCAGCTGGAAAATGTGATAGG - Intergenic
1044624136 8:94219685-94219707 CCTCAACTGTAAATGGGGATTGG - Intergenic
1044899943 8:96933670-96933692 CCTTATCTGTAAAATGAAATGGG + Intronic
1044954852 8:97469418-97469440 CCTCATCTGTAAAATGGGGACGG + Intergenic
1045579686 8:103465269-103465291 CCTCATCTGTAAAATGGGTGTGG - Intergenic
1045666915 8:104497829-104497851 CCGAATCTTTAAAATGTGATGGG - Exonic
1045955041 8:107896016-107896038 CCTCATCTTACAAAGATGATGGG + Intergenic
1046793141 8:118343079-118343101 CCTCATCTGTAAGATGAGAAGGG + Intronic
1047859228 8:128946404-128946426 CATGATCTTTAAGAGGTGATGGG - Intergenic
1048456173 8:134580146-134580168 CCTCATCAGTAAACTGGGATAGG - Intronic
1048677401 8:136798974-136798996 TCTCATCTCTAAAAGGAGAGAGG + Intergenic
1048754386 8:137720047-137720069 CTTTATCTGTAAAATATGATTGG - Intergenic
1049201778 8:141343856-141343878 CCTCACCTGGAAAAGGGGCTTGG + Intergenic
1049378286 8:142299439-142299461 CCTCATCTGCAGAAGGCGCTAGG - Intronic
1049952356 9:657672-657694 CCTCACCTGAAAATGGTTATGGG - Intronic
1050016847 9:1242885-1242907 CCTCATCTGTTAAAGAAGAAAGG + Intergenic
1050459662 9:5866880-5866902 CCTCATCTGTAAAATGGGACTGG + Intergenic
1050565654 9:6879762-6879784 CCTAATTTGTAAAATGTGGTTGG + Intronic
1050624532 9:7488763-7488785 TCTCCTATGTAAAAGGTGCTAGG - Intergenic
1050965694 9:11798753-11798775 CTTTATCTGAAAAAGGTGAGAGG - Intergenic
1051250944 9:15158074-15158096 AATAATCTGTAGAAGGTGATAGG - Intergenic
1053454808 9:38225873-38225895 CCTCATCTGTAAAAGGTGGGGGG + Intergenic
1053541241 9:38976000-38976022 CTTCCTCTGTAATGGGTGATGGG - Intergenic
1053805663 9:41799046-41799068 CTTCCTCTGTAATGGGTGATGGG - Intergenic
1054624897 9:67387906-67387928 CTTCCTCTGTAATGGGTGATGGG + Intergenic
1054828796 9:69600352-69600374 CCTCATCTGTAAAATGGGAGTGG + Intronic
1055585658 9:77756812-77756834 CCTTATCTGTAAAATGAGAAGGG + Intronic
1056302843 9:85259470-85259492 CCTCATCTGTAAAATGTATCAGG - Intergenic
1057180734 9:93028716-93028738 CCTCACCTGTAAAATGGGATGGG - Intronic
1057417960 9:94882171-94882193 CGTCATCTTTAAAGGGTGAAAGG + Intronic
1057483156 9:95461626-95461648 CCTCATCTGTCAAATGGGACAGG - Intronic
1057620020 9:96626534-96626556 CATCATCTGCAAAGGGTGAAGGG - Intergenic
1057715745 9:97494040-97494062 CCTCATCTTACAAAGATGATGGG + Intronic
1057910613 9:99017227-99017249 CCTCTTCAGTATAAGGTGAATGG + Intronic
1058346743 9:103972589-103972611 CCTAATCAGTAAATGGTGCTGGG - Intergenic
1058886013 9:109321323-109321345 CCTCTTCTGGAAAAGGAGAGGGG + Intergenic
1059547338 9:115191090-115191112 CCTCTTCAATAAAGGGTGATAGG + Intronic
1059788643 9:117615628-117615650 CCTAATCTGTAAAATGGGAATGG - Intergenic
1059930604 9:119256693-119256715 CCTCATCTGTAAAATGGGGTGGG + Intronic
1060153742 9:121304735-121304757 TCTCATCTGTAAAATGGAATGGG - Intronic
1060157447 9:121329483-121329505 CCTCATCTGTAAACTGGGAGTGG + Intronic
1060218602 9:121752881-121752903 CCTCATCTGAAAAAGGAGGAAGG - Intronic
1060392756 9:123291901-123291923 TCTCATCTGTAAAATGTGCAGGG - Intergenic
1060395839 9:123315769-123315791 GCTCATCTGGAAAAGGTCACAGG - Intergenic
1060562567 9:124558636-124558658 CCTCATCTGTAAAATGTTGAGGG - Intronic
1060583595 9:124772047-124772069 CCCTATCTGTAAAAGGGGGTTGG + Intergenic
1060825718 9:126686793-126686815 GCTCATCTGTAAAATGGGAATGG + Intronic
1060962910 9:127693790-127693812 CCTCATCTGTAGAATGGGAGAGG - Intronic
1060973869 9:127753941-127753963 CCTCATCCGTTAAAGGGGCTGGG + Intronic
1061045132 9:128160684-128160706 CCCCATCTGTAAAACGGGACTGG - Intronic
1061049335 9:128185404-128185426 CCTCATCTGTAAAATGAGGGGGG - Intronic
1061946361 9:133910447-133910469 CCTCATCTGTCAAATGGGCTTGG - Intronic
1061958862 9:133977887-133977909 CCTCAGCTGGCAAAGGGGATGGG + Intronic
1062037020 9:134386890-134386912 CCTCATCTTTAAAATGGGAGTGG - Intronic
1186773437 X:12839958-12839980 CCTCATCTGTAAAATAAGATGGG - Intergenic
1187054406 X:15728584-15728606 CCTATTCAATAAAAGGTGATGGG - Intronic
1187118433 X:16378894-16378916 CCTCATTTGTAAAATATGAACGG + Intergenic
1187121900 X:16417317-16417339 CCTCACCTGTAAAATGAGAATGG - Intergenic
1187248764 X:17577855-17577877 TCTCATCTTTAAAAAGGGATAGG + Intronic
1187652510 X:21424503-21424525 CCTCAACTGTATAGGGTGAAAGG - Intronic
1188823521 X:34802628-34802650 CCTCAGCTTATAAAGGTGATGGG - Intergenic
1189298219 X:39934062-39934084 CTTCATCTGTAAAATGTGAAGGG + Intergenic
1189530546 X:41877317-41877339 ACTCATCTGTACAAAGAGATTGG - Intronic
1190115647 X:47624789-47624811 CCTCATCTGCAAAATGAGAATGG + Intronic
1190886283 X:54533077-54533099 CCTCATCTGTAAATTGAGAATGG - Intronic
1190918995 X:54832448-54832470 TCTCTTCAGTAAAAGGTGCTGGG - Intergenic
1191178805 X:57537349-57537371 CCTCAGCAGTAAAAGCTGCTGGG + Intergenic
1192157936 X:68760283-68760305 CCTCATCTGTAAAATGGGGATGG + Intergenic
1192749394 X:73972988-73973010 CCTCTTCAGTAAATGGTGTTGGG - Intergenic
1192847671 X:74923576-74923598 CCTCATGTGTAAAAGATGTAAGG + Intronic
1193385427 X:80865450-80865472 CTTCATCTGTAAAATGTGAGGGG - Intergenic
1193431293 X:81409424-81409446 CCTCAACTGTAAAAGGAGAGTGG + Intergenic
1194022079 X:88703255-88703277 CCTCTTCAGTAAATGGTGCTGGG + Intergenic
1196601681 X:117607881-117607903 CCCCATCTGTAACAGCTGAGGGG - Intergenic
1196794295 X:119489877-119489899 CCTCATCTGTAAAATGGGGAGGG + Intergenic
1196816430 X:119668649-119668671 CCTCATCTATAAAATGTGGAGGG + Intronic
1196889407 X:120277605-120277627 CTTCATCTGTAAAATGTGCATGG - Intronic
1197679953 X:129371973-129371995 CCTCTTCTGTAAGAGTTGCTAGG + Intergenic
1197721736 X:129749897-129749919 CCTTATCTGTAAAATGGGATGGG + Intronic
1198027277 X:132719494-132719516 CCTCACGTGTAAAAGGAGATAGG - Intronic
1198399681 X:136256802-136256824 CCTCATCTGTAAAATGAGGATGG - Intergenic
1198513037 X:137373490-137373512 CCTCATCTATAAAAAGGGCTTGG - Intergenic
1198575843 X:138009484-138009506 CCTCATCTGAAAAATGTGGTGGG + Intergenic
1198612691 X:138419205-138419227 CCTCTTCAGTAAATGGTGCTGGG - Intergenic
1198729271 X:139710662-139710684 CCTCATCAATAAATGGTGTTGGG - Intergenic
1199331156 X:146561115-146561137 CCTCATCTCTCAAAAGTGCTAGG - Intergenic
1199751506 X:150823881-150823903 CCTCCTGAGTAAGAGGTGATTGG - Intronic
1199927780 X:152486849-152486871 CCAGATCTGCAAAAGGTGGTTGG - Intergenic
1200829525 Y:7677781-7677803 TTTTATCTGTAAAAGGGGATGGG - Intergenic
1202109243 Y:21404571-21404593 TTTTATCTGTAAAAGGGGATGGG - Intergenic