ID: 1080037072

View in Genome Browser
Species Human (GRCh38)
Location 11:27721199-27721221
Sequence CGTGGAACAAACTTGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 101}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080037072 Original CRISPR CGTGGAACAAACTTGGAGCT GGG (reversed) Intronic
900382863 1:2393546-2393568 CGTGGAGCACCCTTGGAGCCGGG - Intronic
901758049 1:11453323-11453345 TGTGGAACAAGCTTTGATCTGGG + Intergenic
902955171 1:19920565-19920587 CGTGAAACAACCCGGGAGCTTGG - Intronic
905253674 1:36666085-36666107 CGTGGAAGTATCTTGGAGCAGGG - Intergenic
908126887 1:61041104-61041126 CATGTAACAAAGTTGCAGCTGGG - Intronic
911669812 1:100594898-100594920 CTTGGAAGAAGCTGGGAGCTAGG + Intergenic
912310617 1:108617436-108617458 AGAGGAACAAATTGGGAGCTTGG + Intronic
913307681 1:117450024-117450046 TGTGGAACAACTTTGGAACTGGG + Intronic
916226013 1:162490191-162490213 CTTGGAACAGACTAGTAGCTGGG + Intergenic
920229972 1:204463779-204463801 TGTGGAAAGAGCTTGGAGCTGGG - Intronic
924441035 1:244085587-244085609 CCTGGCACAAAATAGGAGCTTGG + Intergenic
1063886825 10:10588338-10588360 TGTGGGACAAGGTTGGAGCTAGG - Intergenic
1067223505 10:44360788-44360810 CGTGGCACAAAATTGGCACTTGG + Intergenic
1067666817 10:48286116-48286138 CCTGGAACAAACTGGGACCTTGG - Intergenic
1069729834 10:70603389-70603411 CGAGGAACATGCTTGGAGTTCGG - Intergenic
1073097947 10:100991547-100991569 GATGGAACAAACATGGAGCTGGG + Intronic
1073267167 10:102234708-102234730 CATGGAAGCAACATGGAGCTGGG + Intronic
1079698390 11:23513243-23513265 TGTGGACCCAACTTGCAGCTGGG - Intergenic
1079980004 11:27140987-27141009 CATGGAACAGCCATGGAGCTGGG - Intergenic
1080037072 11:27721199-27721221 CGTGGAACAAACTTGGAGCTGGG - Intronic
1084304768 11:68274691-68274713 AGCTGAATAAACTTGGAGCTTGG + Intergenic
1092979351 12:13778105-13778127 TGTGGAACAACCATGGAGATAGG - Intronic
1093744280 12:22722000-22722022 CACGGAAGAAACTTGGAGGTAGG + Intergenic
1095308086 12:40661862-40661884 TGTGGAAGCAACTTGGAACTGGG + Intergenic
1099251488 12:80260780-80260802 GGTGGAACTGACTTAGAGCTTGG - Intronic
1099551227 12:84045909-84045931 AATGGCACAAACTTGGATCTCGG + Intergenic
1103193695 12:119024276-119024298 CTCGGGAAAAACTTGGAGCTGGG - Intronic
1108166490 13:47698817-47698839 TGTGGAATAAACTTGGAACAGGG - Intergenic
1108244796 13:48503597-48503619 AGTGGCACAATCTTGGATCTTGG + Intronic
1111339062 13:86860473-86860495 AGTGGAGCTAATTTGGAGCTTGG - Intergenic
1114839662 14:26248436-26248458 CGTGGAAGAGACTTGGAACTGGG + Intergenic
1115445341 14:33483490-33483512 AGTGAAATAAACTTGGACCTGGG + Intronic
1115531417 14:34331732-34331754 GGTGGAACAAACTGGGGGCTCGG - Intronic
1115789907 14:36867060-36867082 TGTGGAACAAGCTTTGAGATGGG - Intronic
1116195876 14:41723979-41724001 CCTGGAGCTAACTTGGAGATAGG - Intronic
1120246278 14:82010973-82010995 CGTGGAACTCTCTTGTAGCTAGG - Intergenic
1121175178 14:91885524-91885546 CCTGGAACCAGCCTGGAGCTGGG + Intronic
1121250652 14:92497293-92497315 GGTGGAAGAAACCTGGACCTTGG - Exonic
1128638022 15:69315609-69315631 GGTGAAACACACTTGGAGATAGG - Intronic
1138319359 16:56098678-56098700 GGTGGAGCCAGCTTGGAGCTAGG - Intergenic
1138936467 16:61731384-61731406 CGTGGAACAAATTATGACCTAGG + Intronic
1139791109 16:69436163-69436185 CCTGGAACATAATGGGAGCTGGG - Intronic
1143899410 17:10162524-10162546 CGTGGAGCAAACTGGGACTTCGG - Intronic
1144766672 17:17736973-17736995 AGTGGAACATTCTTGGAGTTAGG + Intronic
1147688656 17:42301866-42301888 CCTGCAACAAGCTTGGTGCTAGG + Intronic
1151672334 17:75578138-75578160 GTTGGAGCAAACTTGTAGCTGGG + Intergenic
1152482743 17:80566080-80566102 CGTGGAACCAGCTTGGAGAAAGG - Intronic
1154201805 18:12305484-12305506 CGTGGGACAGAATTGGAGGTGGG + Intergenic
1157577590 18:48754070-48754092 ACTGGAACAGACTTGGAGTTAGG - Intronic
1158475754 18:57777964-57777986 GGTGGAACAAAACTGAAGCTTGG + Intronic
1165723155 19:38093817-38093839 GCAGGAACAGACTTGGAGCTGGG + Intronic
1166360789 19:42252230-42252252 GGTGGAAGTAACATGGAGCTTGG - Intronic
926425771 2:12737212-12737234 AGTGGAACAAGCATGGATCTTGG - Intronic
931987545 2:67756250-67756272 GGTGTAAGAAAGTTGGAGCTTGG + Intergenic
937443019 2:121932960-121932982 CAGGGAACCCACTTGGAGCTAGG - Intergenic
939894748 2:147777535-147777557 AGAGAAACATACTTGGAGCTAGG - Intergenic
940688482 2:156884178-156884200 AGTGGGACAAAATTGCAGCTAGG - Intergenic
941587723 2:167380692-167380714 CCTGGAACAAACTTGGGGAGAGG - Intergenic
943429630 2:187783091-187783113 CCTGGATCAGAGTTGGAGCTGGG + Intergenic
945609031 2:211974702-211974724 AGTGGAACAATCTTAGACCTTGG - Intronic
946516776 2:220420569-220420591 GGAGGAAGAAGCTTGGAGCTGGG + Intergenic
1172046541 20:32084499-32084521 TGGAGAAGAAACTTGGAGCTGGG + Exonic
1173185894 20:40839920-40839942 AATGGAACAAACTTGGAGACTGG + Intergenic
1173856326 20:46252687-46252709 CCTGGCACAAAGTTGAAGCTTGG - Intronic
1177354017 21:19983750-19983772 TGTGGAAAAAAATTGGACCTAGG + Intergenic
1181887511 22:26033044-26033066 TGTGGACCAAGCTGGGAGCTTGG - Intergenic
1183395078 22:37566885-37566907 CTTGGAGCTCACTTGGAGCTTGG - Intronic
950171664 3:10843075-10843097 CGTGGAACAAGCTTGGAGAGGGG + Intronic
950893731 3:16428694-16428716 CGTTGTACACACATGGAGCTAGG - Intronic
951183389 3:19684446-19684468 CGTGGGTAAAACTGGGAGCTTGG - Intergenic
951573374 3:24088894-24088916 GGTTGAATAAGCTTGGAGCTTGG + Intergenic
954395318 3:50290336-50290358 CCTTGATCACACTTGGAGCTGGG + Intronic
962144311 3:132824035-132824057 GTTGGAAGAAACTTGGAGCTAGG - Intergenic
966733453 3:183169404-183169426 TGTGGAACAACTTTGGAACTGGG - Intergenic
975064507 4:70043463-70043485 AGTGGCCCAAACTTGGAGCTAGG - Intergenic
975066005 4:70064285-70064307 AGTTGCCCAAACTTGGAGCTAGG - Intergenic
975642994 4:76518920-76518942 AGTGGAACAAGAATGGAGCTAGG + Intronic
975854208 4:78606034-78606056 CCTGGAACAAAGTGGAAGCTGGG + Intronic
985973468 5:3395128-3395150 CTTAGAACAAACAGGGAGCTTGG + Intergenic
986844760 5:11739404-11739426 GGTGGAACAGACTTGGGGCAGGG + Intronic
991448242 5:66723388-66723410 AGTGGAACAAACTTAGTTCTAGG - Intronic
994707603 5:103224497-103224519 CTGGGAACAGACTTGGAGATGGG + Intergenic
996353576 5:122572810-122572832 TGTGGAACAAAATTGCAGTTTGG - Intergenic
997263055 5:132478321-132478343 CGTGGTACACACGTGGTGCTTGG + Intergenic
1000406316 5:160892188-160892210 CTTGGAAGGAGCTTGGAGCTTGG - Intergenic
1003612059 6:7622606-7622628 CGTGGAATAACCTGGGAACTTGG + Intergenic
1005155053 6:22794866-22794888 AGTGGTGCAAACTTGGAACTCGG - Intergenic
1008032084 6:46707942-46707964 TGTGAAACAAACTTGAAGCTTGG - Intronic
1014042788 6:116849395-116849417 TGTGGAACAGCTTTGGAGCTGGG + Intergenic
1015976887 6:138799608-138799630 AGTGGCACAATCTTGGACCTTGG + Intronic
1016758443 6:147712457-147712479 AGCGGAAAAAACATGGAGCTAGG - Intronic
1017445795 6:154506192-154506214 CCTGAAAAAAACTTGGAGTTTGG - Intronic
1021496709 7:21283148-21283170 CCAGGAACAAACCTAGAGCTGGG + Intergenic
1024123847 7:46271487-46271509 CGTGGAAGAAACCTGGAGGCAGG - Intergenic
1027907962 7:84210679-84210701 CTAGGAACAAACATGGAACTAGG + Intronic
1029730472 7:102434785-102434807 GGTGGAAGACACTTGGAGCCTGG - Intronic
1032289340 7:130574386-130574408 CCTGGTACCAGCTTGGAGCTGGG + Intronic
1033458069 7:141520272-141520294 AGTGGACCAGGCTTGGAGCTGGG + Intergenic
1035395157 7:158530026-158530048 TGTGACAGAAACTTGGAGCTAGG - Intronic
1036448939 8:8848166-8848188 GGTGGAACACTCTGGGAGCTCGG - Intronic
1044188344 8:89283078-89283100 TGTGGAAGCAACTTGGAACTGGG + Intergenic
1045645595 8:104294028-104294050 CTTGTAACAAAGTAGGAGCTTGG - Intergenic
1045796885 8:106056865-106056887 CGGGGAACAAATTTGGAGAACGG - Intergenic
1049562085 8:143316984-143317006 CTGGGGACAACCTTGGAGCTGGG - Intronic
1052150899 9:25114195-25114217 AGTGGAACTGACATGGAGCTTGG - Intergenic
1059379813 9:113914272-113914294 CCTGGAACAAACATGGACTTTGG - Intronic
1061681314 9:132243734-132243756 AGTGGAACAAACTTGGCCTTGGG + Exonic
1062664939 9:137665297-137665319 CCTGTAAGAAATTTGGAGCTGGG + Intronic
1196802785 X:119558590-119558612 CCTGGAACATAGTAGGAGCTCGG + Intronic
1197472522 X:126881174-126881196 CCTGGAGCTAACTTGGAGCAAGG + Intergenic