ID: 1080041522

View in Genome Browser
Species Human (GRCh38)
Location 11:27764205-27764227
Sequence CTCTGGACATGGAGGGAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080041522_1080041528 -9 Left 1080041522 11:27764205-27764227 CCTTATTCCCTCCATGTCCAGAG No data
Right 1080041528 11:27764219-27764241 TGTCCAGAGCAGGGAATAACTGG No data
1080041522_1080041530 6 Left 1080041522 11:27764205-27764227 CCTTATTCCCTCCATGTCCAGAG No data
Right 1080041530 11:27764234-27764256 ATAACTGGATTTTCTGTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080041522 Original CRISPR CTCTGGACATGGAGGGAATA AGG (reversed) Intergenic
No off target data available for this crispr