ID: 1080044480

View in Genome Browser
Species Human (GRCh38)
Location 11:27794872-27794894
Sequence TTCTGCAGGCTATACAAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080044475_1080044480 25 Left 1080044475 11:27794824-27794846 CCTGAGACTGGATAATTTATAAG 0: 34
1: 1122
2: 8813
3: 14799
4: 14305
Right 1080044480 11:27794872-27794894 TTCTGCAGGCTATACAAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080044480 Original CRISPR TTCTGCAGGCTATACAAGGA TGG Intergenic
No off target data available for this crispr