ID: 1080045611

View in Genome Browser
Species Human (GRCh38)
Location 11:27804721-27804743
Sequence CTTTATATCAGACCTGTGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080045607_1080045611 29 Left 1080045607 11:27804669-27804691 CCTTCTTTCATTCATTGGTTTTT No data
Right 1080045611 11:27804721-27804743 CTTTATATCAGACCTGTGTTAGG No data
1080045609_1080045611 6 Left 1080045609 11:27804692-27804714 CCATTTAACAAATATTTGTGGAG No data
Right 1080045611 11:27804721-27804743 CTTTATATCAGACCTGTGTTAGG No data
1080045606_1080045611 30 Left 1080045606 11:27804668-27804690 CCCTTCTTTCATTCATTGGTTTT No data
Right 1080045611 11:27804721-27804743 CTTTATATCAGACCTGTGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080045611 Original CRISPR CTTTATATCAGACCTGTGTT AGG Intergenic
No off target data available for this crispr