ID: 1080047637

View in Genome Browser
Species Human (GRCh38)
Location 11:27826374-27826396
Sequence TACCACTGGATTGCTGCTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080047634_1080047637 27 Left 1080047634 11:27826324-27826346 CCTAGTGGTAGGGGAACACTGGG No data
Right 1080047637 11:27826374-27826396 TACCACTGGATTGCTGCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080047637 Original CRISPR TACCACTGGATTGCTGCTTT AGG Intergenic
No off target data available for this crispr