ID: 1080048623

View in Genome Browser
Species Human (GRCh38)
Location 11:27835946-27835968
Sequence CACTCTCTCCTGAGGCTCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080048615_1080048623 25 Left 1080048615 11:27835898-27835920 CCAAAATCCATATCACTGGATTT No data
Right 1080048623 11:27835946-27835968 CACTCTCTCCTGAGGCTCTAAGG No data
1080048616_1080048623 18 Left 1080048616 11:27835905-27835927 CCATATCACTGGATTTAAAATCA No data
Right 1080048623 11:27835946-27835968 CACTCTCTCCTGAGGCTCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080048623 Original CRISPR CACTCTCTCCTGAGGCTCTA AGG Intergenic
No off target data available for this crispr