ID: 1080049580

View in Genome Browser
Species Human (GRCh38)
Location 11:27845807-27845829
Sequence CTGTGGAGATTGAGAGAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080049580_1080049582 2 Left 1080049580 11:27845807-27845829 CCTTTTTCTCTCAATCTCCACAG No data
Right 1080049582 11:27845832-27845854 ACTTACCATCACTGCTTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080049580 Original CRISPR CTGTGGAGATTGAGAGAAAA AGG (reversed) Intergenic
No off target data available for this crispr