ID: 1080050653

View in Genome Browser
Species Human (GRCh38)
Location 11:27855827-27855849
Sequence CCTTTCTTACCTGGGCTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080050653_1080050664 5 Left 1080050653 11:27855827-27855849 CCCCCCAGCCCAGGTAAGAAAGG No data
Right 1080050664 11:27855855-27855877 TGGAGGATCTGCCTGACCCCGGG No data
1080050653_1080050665 6 Left 1080050653 11:27855827-27855849 CCCCCCAGCCCAGGTAAGAAAGG No data
Right 1080050665 11:27855856-27855878 GGAGGATCTGCCTGACCCCGGGG No data
1080050653_1080050668 18 Left 1080050653 11:27855827-27855849 CCCCCCAGCCCAGGTAAGAAAGG No data
Right 1080050668 11:27855868-27855890 TGACCCCGGGGATACTGATAGGG No data
1080050653_1080050673 30 Left 1080050653 11:27855827-27855849 CCCCCCAGCCCAGGTAAGAAAGG No data
Right 1080050673 11:27855880-27855902 TACTGATAGGGTCCTTTTCAGGG No data
1080050653_1080050672 29 Left 1080050653 11:27855827-27855849 CCCCCCAGCCCAGGTAAGAAAGG No data
Right 1080050672 11:27855879-27855901 ATACTGATAGGGTCCTTTTCAGG No data
1080050653_1080050667 17 Left 1080050653 11:27855827-27855849 CCCCCCAGCCCAGGTAAGAAAGG No data
Right 1080050667 11:27855867-27855889 CTGACCCCGGGGATACTGATAGG No data
1080050653_1080050663 4 Left 1080050653 11:27855827-27855849 CCCCCCAGCCCAGGTAAGAAAGG No data
Right 1080050663 11:27855854-27855876 ATGGAGGATCTGCCTGACCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080050653 Original CRISPR CCTTTCTTACCTGGGCTGGG GGG (reversed) Intergenic
No off target data available for this crispr