ID: 1080050663

View in Genome Browser
Species Human (GRCh38)
Location 11:27855854-27855876
Sequence ATGGAGGATCTGCCTGACCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080050659_1080050663 -4 Left 1080050659 11:27855835-27855857 CCCAGGTAAGAAAGGCTAGATGG No data
Right 1080050663 11:27855854-27855876 ATGGAGGATCTGCCTGACCCCGG No data
1080050653_1080050663 4 Left 1080050653 11:27855827-27855849 CCCCCCAGCCCAGGTAAGAAAGG No data
Right 1080050663 11:27855854-27855876 ATGGAGGATCTGCCTGACCCCGG No data
1080050651_1080050663 14 Left 1080050651 11:27855817-27855839 CCTTCAAGTACCCCCCAGCCCAG No data
Right 1080050663 11:27855854-27855876 ATGGAGGATCTGCCTGACCCCGG No data
1080050658_1080050663 0 Left 1080050658 11:27855831-27855853 CCAGCCCAGGTAAGAAAGGCTAG No data
Right 1080050663 11:27855854-27855876 ATGGAGGATCTGCCTGACCCCGG No data
1080050650_1080050663 22 Left 1080050650 11:27855809-27855831 CCAAGTGGCCTTCAAGTACCCCC No data
Right 1080050663 11:27855854-27855876 ATGGAGGATCTGCCTGACCCCGG No data
1080050661_1080050663 -5 Left 1080050661 11:27855836-27855858 CCAGGTAAGAAAGGCTAGATGGA No data
Right 1080050663 11:27855854-27855876 ATGGAGGATCTGCCTGACCCCGG No data
1080050656_1080050663 2 Left 1080050656 11:27855829-27855851 CCCCAGCCCAGGTAAGAAAGGCT No data
Right 1080050663 11:27855854-27855876 ATGGAGGATCTGCCTGACCCCGG No data
1080050657_1080050663 1 Left 1080050657 11:27855830-27855852 CCCAGCCCAGGTAAGAAAGGCTA No data
Right 1080050663 11:27855854-27855876 ATGGAGGATCTGCCTGACCCCGG No data
1080050655_1080050663 3 Left 1080050655 11:27855828-27855850 CCCCCAGCCCAGGTAAGAAAGGC No data
Right 1080050663 11:27855854-27855876 ATGGAGGATCTGCCTGACCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080050663 Original CRISPR ATGGAGGATCTGCCTGACCC CGG Intergenic
No off target data available for this crispr