ID: 1080050667

View in Genome Browser
Species Human (GRCh38)
Location 11:27855867-27855889
Sequence CTGACCCCGGGGATACTGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080050657_1080050667 14 Left 1080050657 11:27855830-27855852 CCCAGCCCAGGTAAGAAAGGCTA No data
Right 1080050667 11:27855867-27855889 CTGACCCCGGGGATACTGATAGG No data
1080050659_1080050667 9 Left 1080050659 11:27855835-27855857 CCCAGGTAAGAAAGGCTAGATGG No data
Right 1080050667 11:27855867-27855889 CTGACCCCGGGGATACTGATAGG No data
1080050651_1080050667 27 Left 1080050651 11:27855817-27855839 CCTTCAAGTACCCCCCAGCCCAG No data
Right 1080050667 11:27855867-27855889 CTGACCCCGGGGATACTGATAGG No data
1080050656_1080050667 15 Left 1080050656 11:27855829-27855851 CCCCAGCCCAGGTAAGAAAGGCT No data
Right 1080050667 11:27855867-27855889 CTGACCCCGGGGATACTGATAGG No data
1080050655_1080050667 16 Left 1080050655 11:27855828-27855850 CCCCCAGCCCAGGTAAGAAAGGC No data
Right 1080050667 11:27855867-27855889 CTGACCCCGGGGATACTGATAGG No data
1080050653_1080050667 17 Left 1080050653 11:27855827-27855849 CCCCCCAGCCCAGGTAAGAAAGG No data
Right 1080050667 11:27855867-27855889 CTGACCCCGGGGATACTGATAGG No data
1080050661_1080050667 8 Left 1080050661 11:27855836-27855858 CCAGGTAAGAAAGGCTAGATGGA No data
Right 1080050667 11:27855867-27855889 CTGACCCCGGGGATACTGATAGG No data
1080050658_1080050667 13 Left 1080050658 11:27855831-27855853 CCAGCCCAGGTAAGAAAGGCTAG No data
Right 1080050667 11:27855867-27855889 CTGACCCCGGGGATACTGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080050667 Original CRISPR CTGACCCCGGGGATACTGAT AGG Intergenic
No off target data available for this crispr