ID: 1080050672

View in Genome Browser
Species Human (GRCh38)
Location 11:27855879-27855901
Sequence ATACTGATAGGGTCCTTTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080050657_1080050672 26 Left 1080050657 11:27855830-27855852 CCCAGCCCAGGTAAGAAAGGCTA No data
Right 1080050672 11:27855879-27855901 ATACTGATAGGGTCCTTTTCAGG No data
1080050653_1080050672 29 Left 1080050653 11:27855827-27855849 CCCCCCAGCCCAGGTAAGAAAGG No data
Right 1080050672 11:27855879-27855901 ATACTGATAGGGTCCTTTTCAGG No data
1080050655_1080050672 28 Left 1080050655 11:27855828-27855850 CCCCCAGCCCAGGTAAGAAAGGC No data
Right 1080050672 11:27855879-27855901 ATACTGATAGGGTCCTTTTCAGG No data
1080050659_1080050672 21 Left 1080050659 11:27855835-27855857 CCCAGGTAAGAAAGGCTAGATGG No data
Right 1080050672 11:27855879-27855901 ATACTGATAGGGTCCTTTTCAGG No data
1080050661_1080050672 20 Left 1080050661 11:27855836-27855858 CCAGGTAAGAAAGGCTAGATGGA No data
Right 1080050672 11:27855879-27855901 ATACTGATAGGGTCCTTTTCAGG No data
1080050658_1080050672 25 Left 1080050658 11:27855831-27855853 CCAGCCCAGGTAAGAAAGGCTAG No data
Right 1080050672 11:27855879-27855901 ATACTGATAGGGTCCTTTTCAGG No data
1080050656_1080050672 27 Left 1080050656 11:27855829-27855851 CCCCAGCCCAGGTAAGAAAGGCT No data
Right 1080050672 11:27855879-27855901 ATACTGATAGGGTCCTTTTCAGG No data
1080050666_1080050672 -10 Left 1080050666 11:27855866-27855888 CCTGACCCCGGGGATACTGATAG No data
Right 1080050672 11:27855879-27855901 ATACTGATAGGGTCCTTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080050672 Original CRISPR ATACTGATAGGGTCCTTTTC AGG Intergenic
No off target data available for this crispr