ID: 1080051321

View in Genome Browser
Species Human (GRCh38)
Location 11:27861873-27861895
Sequence GCGTTGAGCTAGACAAAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080051321_1080051323 -1 Left 1080051321 11:27861873-27861895 CCCACTTTTGTCTAGCTCAACGC No data
Right 1080051323 11:27861895-27861917 CAGTCACATGATGCTGACGAAGG No data
1080051321_1080051325 18 Left 1080051321 11:27861873-27861895 CCCACTTTTGTCTAGCTCAACGC No data
Right 1080051325 11:27861914-27861936 AAGGTTAGCCTTAGAAGTTAGGG No data
1080051321_1080051324 17 Left 1080051321 11:27861873-27861895 CCCACTTTTGTCTAGCTCAACGC No data
Right 1080051324 11:27861913-27861935 GAAGGTTAGCCTTAGAAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080051321 Original CRISPR GCGTTGAGCTAGACAAAAGT GGG (reversed) Intergenic
No off target data available for this crispr