ID: 1080051323

View in Genome Browser
Species Human (GRCh38)
Location 11:27861895-27861917
Sequence CAGTCACATGATGCTGACGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080051322_1080051323 -2 Left 1080051322 11:27861874-27861896 CCACTTTTGTCTAGCTCAACGCA No data
Right 1080051323 11:27861895-27861917 CAGTCACATGATGCTGACGAAGG No data
1080051321_1080051323 -1 Left 1080051321 11:27861873-27861895 CCCACTTTTGTCTAGCTCAACGC No data
Right 1080051323 11:27861895-27861917 CAGTCACATGATGCTGACGAAGG No data
1080051320_1080051323 0 Left 1080051320 11:27861872-27861894 CCCCACTTTTGTCTAGCTCAACG No data
Right 1080051323 11:27861895-27861917 CAGTCACATGATGCTGACGAAGG No data
1080051318_1080051323 16 Left 1080051318 11:27861856-27861878 CCTGTTGCCTCTTTCTCCCCACT No data
Right 1080051323 11:27861895-27861917 CAGTCACATGATGCTGACGAAGG No data
1080051319_1080051323 9 Left 1080051319 11:27861863-27861885 CCTCTTTCTCCCCACTTTTGTCT No data
Right 1080051323 11:27861895-27861917 CAGTCACATGATGCTGACGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080051323 Original CRISPR CAGTCACATGATGCTGACGA AGG Intergenic
No off target data available for this crispr