ID: 1080051629

View in Genome Browser
Species Human (GRCh38)
Location 11:27864473-27864495
Sequence TACTGATGGTAGGAGCTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080051629_1080051635 15 Left 1080051629 11:27864473-27864495 CCTCCCAGCTCCTACCATCAGTA No data
Right 1080051635 11:27864511-27864533 ACTCCTGAGTCTCCTAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080051629 Original CRISPR TACTGATGGTAGGAGCTGGG AGG (reversed) Intergenic
No off target data available for this crispr