ID: 1080054110

View in Genome Browser
Species Human (GRCh38)
Location 11:27887425-27887447
Sequence GTGGTGTAGATCATCATTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080054106_1080054110 28 Left 1080054106 11:27887374-27887396 CCTGACTACAGTAGATGGGCTGT No data
Right 1080054110 11:27887425-27887447 GTGGTGTAGATCATCATTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080054110 Original CRISPR GTGGTGTAGATCATCATTGT TGG Intergenic
No off target data available for this crispr