ID: 1080055260

View in Genome Browser
Species Human (GRCh38)
Location 11:27900349-27900371
Sequence GGAGAAAGACCCTGGCATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080055260_1080055264 7 Left 1080055260 11:27900349-27900371 CCTCCATGCCAGGGTCTTTCTCC No data
Right 1080055264 11:27900379-27900401 TTCCCTTAAAACAGTTTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080055260 Original CRISPR GGAGAAAGACCCTGGCATGG AGG (reversed) Intergenic
No off target data available for this crispr