ID: 1080057600

View in Genome Browser
Species Human (GRCh38)
Location 11:27923275-27923297
Sequence CAGGATTCCATGGGTTCTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080057597_1080057600 -7 Left 1080057597 11:27923259-27923281 CCTATGGATATATTCTCAGGATT No data
Right 1080057600 11:27923275-27923297 CAGGATTCCATGGGTTCTATAGG No data
1080057593_1080057600 20 Left 1080057593 11:27923232-27923254 CCTCTTTTTTTTTTAACCTTATA No data
Right 1080057600 11:27923275-27923297 CAGGATTCCATGGGTTCTATAGG No data
1080057595_1080057600 4 Left 1080057595 11:27923248-27923270 CCTTATAAACTCCTATGGATATA No data
Right 1080057600 11:27923275-27923297 CAGGATTCCATGGGTTCTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080057600 Original CRISPR CAGGATTCCATGGGTTCTAT AGG Intergenic
No off target data available for this crispr