ID: 1080057841

View in Genome Browser
Species Human (GRCh38)
Location 11:27925689-27925711
Sequence TAGGATAAAAAGATGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080057828_1080057841 27 Left 1080057828 11:27925639-27925661 CCTCCCCAGTGTGAATGGCCATC No data
Right 1080057841 11:27925689-27925711 TAGGATAAAAAGATGGAGGAAGG No data
1080057831_1080057841 23 Left 1080057831 11:27925643-27925665 CCCAGTGTGAATGGCCATCAGGC No data
Right 1080057841 11:27925689-27925711 TAGGATAAAAAGATGGAGGAAGG No data
1080057838_1080057841 -7 Left 1080057838 11:27925673-27925695 CCACTGAGGGACTGAATAGGATA No data
Right 1080057841 11:27925689-27925711 TAGGATAAAAAGATGGAGGAAGG No data
1080057832_1080057841 22 Left 1080057832 11:27925644-27925666 CCAGTGTGAATGGCCATCAGGCA No data
Right 1080057841 11:27925689-27925711 TAGGATAAAAAGATGGAGGAAGG No data
1080057836_1080057841 -2 Left 1080057836 11:27925668-27925690 CCAATCCACTGAGGGACTGAATA No data
Right 1080057841 11:27925689-27925711 TAGGATAAAAAGATGGAGGAAGG No data
1080057833_1080057841 9 Left 1080057833 11:27925657-27925679 CCATCAGGCATCCAATCCACTGA No data
Right 1080057841 11:27925689-27925711 TAGGATAAAAAGATGGAGGAAGG No data
1080057829_1080057841 24 Left 1080057829 11:27925642-27925664 CCCCAGTGTGAATGGCCATCAGG No data
Right 1080057841 11:27925689-27925711 TAGGATAAAAAGATGGAGGAAGG No data
1080057827_1080057841 28 Left 1080057827 11:27925638-27925660 CCCTCCCCAGTGTGAATGGCCAT No data
Right 1080057841 11:27925689-27925711 TAGGATAAAAAGATGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080057841 Original CRISPR TAGGATAAAAAGATGGAGGA AGG Intergenic
No off target data available for this crispr