ID: 1080060371

View in Genome Browser
Species Human (GRCh38)
Location 11:27950299-27950321
Sequence CTACAAAAACTGAGAGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080060365_1080060371 28 Left 1080060365 11:27950248-27950270 CCACAGGCAAGGCACTATGCTAA No data
Right 1080060371 11:27950299-27950321 CTACAAAAACTGAGAGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080060371 Original CRISPR CTACAAAAACTGAGAGAGCT GGG Intergenic
No off target data available for this crispr