ID: 1080065565

View in Genome Browser
Species Human (GRCh38)
Location 11:28008485-28008507
Sequence CTTGGCAAGGCTGTCATTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080065565_1080065570 15 Left 1080065565 11:28008485-28008507 CCTACAATGACAGCCTTGCCAAG No data
Right 1080065570 11:28008523-28008545 TATCCCTCTACCCACACGAAGGG No data
1080065565_1080065569 14 Left 1080065565 11:28008485-28008507 CCTACAATGACAGCCTTGCCAAG No data
Right 1080065569 11:28008522-28008544 ATATCCCTCTACCCACACGAAGG No data
1080065565_1080065571 16 Left 1080065565 11:28008485-28008507 CCTACAATGACAGCCTTGCCAAG No data
Right 1080065571 11:28008524-28008546 ATCCCTCTACCCACACGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080065565 Original CRISPR CTTGGCAAGGCTGTCATTGT AGG (reversed) Intergenic
No off target data available for this crispr