ID: 1080066661

View in Genome Browser
Species Human (GRCh38)
Location 11:28023837-28023859
Sequence TGTTTGATGTAGAACTTGAG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 147}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080066660_1080066661 5 Left 1080066660 11:28023809-28023831 CCAGAATTTACGTCTGCAGTTAA 0: 1
1: 0
2: 0
3: 8
4: 81
Right 1080066661 11:28023837-28023859 TGTTTGATGTAGAACTTGAGAGG 0: 1
1: 0
2: 1
3: 11
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080066661 Original CRISPR TGTTTGATGTAGAACTTGAG AGG Exonic
901292672 1:8136446-8136468 TGTTTGATACAGAGCTTGATGGG + Intergenic
904965258 1:34367374-34367396 TTTTTGCTGTAAAAATTGAGGGG - Intergenic
906827964 1:49002243-49002265 TATTTGATCTAGATCTTGAATGG + Intronic
909230444 1:73082414-73082436 TGTTTGCTGCATAAATTGAGAGG + Intergenic
909920201 1:81372156-81372178 TGATTGATGTAGAATTTGTAAGG - Intronic
913297477 1:117335918-117335940 GGGTTGATGGAGAACTTTAGAGG + Intergenic
916528765 1:165636076-165636098 TGTTTAATGTAGAAGTGGACTGG + Intronic
919006900 1:191909857-191909879 TGTTGGATTTTGAACTTGAATGG - Intergenic
921654965 1:217723634-217723656 TGTTTGATTTAGAACTAAATGGG + Intronic
923171053 1:231417778-231417800 TGTTTGAAGTAGAAATTCAGGGG + Intronic
924071532 1:240285257-240285279 TGTTGGATGTGGAAGGTGAGGGG + Intronic
1066423884 10:35287078-35287100 TTTTTTATGTAGAACTTAAAAGG + Intronic
1071747939 10:88443039-88443061 CGTTGGATGTGGAAGTTGAGAGG - Intronic
1074292708 10:112151952-112151974 TTTTAAATGCAGAACTTGAGAGG + Exonic
1076914547 10:133415530-133415552 TGTTTGTTTTAGTGCTTGAGAGG + Intronic
1076940894 10:133607520-133607542 TGGTAGATGTAAAACTTGACAGG - Intergenic
1077959983 11:7065626-7065648 TGTTTGAAGCACAACTTCAGTGG + Intronic
1080066661 11:28023837-28023859 TGTTTGATGTAGAACTTGAGAGG + Exonic
1081124117 11:39301803-39301825 TGTCTTCTGTAGAACTGGAGAGG + Intergenic
1082777895 11:57261748-57261770 TGATTGGTGTAGGAGTTGAGAGG - Intergenic
1083036655 11:59644165-59644187 TGGTTGATGTTGAAATTGGGTGG - Intronic
1084879856 11:72163179-72163201 AGTTTGATGTACTTCTTGAGAGG - Intergenic
1085359105 11:75870035-75870057 TGTTCCATGTAGAAATTGGGCGG + Intronic
1086107284 11:83158784-83158806 TGTCTAGTGTAAAACTTGAGTGG + Intronic
1090827889 11:130400680-130400702 GATTTGATGTAGGACTTCAGAGG + Intergenic
1091234929 11:134015131-134015153 TTTTTGATGTACAACATGATGGG - Intergenic
1091485520 12:883762-883784 TGTTTGTTGTAGAAATTGGAAGG + Exonic
1095518624 12:43035763-43035785 TGAGTGATGAAGAACTTGGGTGG + Intergenic
1095819362 12:46460421-46460443 TCTTTGATGTAGAAAGTAAGGGG - Intergenic
1096006942 12:48181126-48181148 TGTTTGACCTGGAACTTGACTGG + Intronic
1096164561 12:49410761-49410783 TCTTTGATGTAGAGCTTAAAAGG + Intronic
1100275083 12:93064383-93064405 TGTTTGAGAAAAAACTTGAGGGG - Intergenic
1100482470 12:94992539-94992561 TTTCTCATGTAGAACTTGGGTGG + Intronic
1103639303 12:122336317-122336339 TGTTCGATGTATAACTTGGAAGG + Intronic
1106122777 13:26874856-26874878 TGTTTGATGTATAAAATAAGAGG + Intergenic
1106583897 13:31040334-31040356 TGTTTGAAGAAGAAATTGACTGG + Intergenic
1106876008 13:34073831-34073853 TGTTTCATATATAACTTAAGAGG - Intergenic
1107607025 13:42068961-42068983 TGTTTGATGAGGAATTTGAGGGG + Intronic
1107687106 13:42913299-42913321 TGTTTAAAGTAGATTTTGAGTGG - Intronic
1109667263 13:65555776-65555798 TGTTTGATTTAGAAAGTGGGAGG - Intergenic
1109991650 13:70066509-70066531 TGTTTAATGTAGCACTGAAGAGG - Intronic
1110309576 13:74033243-74033265 TGTTAGTTGTAGAACTTCAAGGG - Intronic
1112039202 13:95529055-95529077 TTTTTAATGTAGAACTGGTGGGG + Intronic
1112269487 13:97955463-97955485 TGTCTGATGGAGAAAATGAGCGG + Intronic
1114373900 14:22122453-22122475 TGTTTTCTGTGGAACTTTAGTGG - Intergenic
1116001966 14:39253375-39253397 TTGTTGATGTTGATCTTGAGCGG + Exonic
1116563492 14:46414864-46414886 TGTTTGTTGTAGTAATTTAGGGG - Intergenic
1116576074 14:46577607-46577629 TGTTGGTTGTAGAATATGAGGGG - Intergenic
1117997884 14:61495093-61495115 TGTTTGATGGTTAATTTGAGAGG + Intronic
1119399731 14:74354790-74354812 TGAGTGATGTAGATCTTTAGTGG + Intronic
1119572196 14:75684863-75684885 TGTTCTATACAGAACTTGAGTGG + Intronic
1122313769 14:100813619-100813641 TGTTTGATGAAGAGTTTGAATGG + Intergenic
1122886972 14:104714499-104714521 TGGTTGCTGGAGAACTTGAGGGG - Exonic
1125380746 15:39084167-39084189 TGGTTGGTGTAGAAGATGAGCGG - Intergenic
1126270526 15:46812170-46812192 TGTTGCATGTATAACTAGAGAGG - Intergenic
1126771859 15:52064948-52064970 TGTTTGATGAGGAATTTGAGGGG - Exonic
1126828754 15:52577751-52577773 TTTTTGATTTGGAACTTGATAGG + Intergenic
1129634614 15:77301863-77301885 TGGTTGATGTTGACCTTGGGAGG - Intronic
1130261570 15:82358358-82358380 TGTTTAAGGTAGAACTGGACTGG + Intergenic
1130279666 15:82510653-82510675 TGTTTAAGGTAGAACTGGACTGG - Intergenic
1130471042 15:84226839-84226861 TGTTTAAGGTAGAACTGGACTGG - Intergenic
1130478536 15:84341409-84341431 TGTTTAAGGTAGAACTGGACTGG - Intergenic
1130493234 15:84446722-84446744 TGTTTAAGGTAGAACTGGACTGG + Intergenic
1130593334 15:85231476-85231498 TGTTTAAGGTAGAACTGGACTGG - Intergenic
1131221219 15:90585842-90585864 GGTGTGATGCAGAACTGGAGGGG + Intronic
1135053978 16:19215217-19215239 TATTTGATGTAGAAGTGGGGAGG + Intronic
1143608557 17:8004356-8004378 TGCTTGATGTTGGACTTGAGAGG - Intronic
1145841557 17:27999469-27999491 AGTTTTATCTATAACTTGAGGGG + Intergenic
1146828643 17:36047341-36047363 TGTTTCAGGTAGGACCTGAGTGG - Intergenic
1147248235 17:39136228-39136250 AGTTTGAGGTGGAACTTCAGGGG - Intronic
1149579516 17:57739480-57739502 TTTTTGATGCAGAACTAAAGAGG - Intergenic
1159971557 18:74661908-74661930 TGTTTGAAGTAGTTCTTGATGGG + Intronic
1164919835 19:32080903-32080925 TGTTTTATGGACAACTTGGGTGG - Intergenic
926131961 2:10308840-10308862 TGTTTCATCAAGAACTTGTGAGG + Intronic
928194923 2:29208660-29208682 TGTTTGATGGAGGCCTTCAGGGG + Intronic
929987623 2:46751773-46751795 TGTTTTATGTAGTACATCAGGGG + Intronic
931494372 2:62786180-62786202 TGGTTGGGGTAGAACATGAGGGG + Intronic
938781025 2:134585009-134585031 TTCTTCATATAGAACTTGAGAGG + Intronic
940928429 2:159394993-159395015 TGTTTGATCTAGAAGCTGGGAGG - Intronic
942432717 2:175931075-175931097 TCTTTAATGTAGAAATTGGGTGG - Intronic
943068918 2:183118742-183118764 GGTTTGTTGAAAAACTTGAGAGG + Intronic
944279294 2:197876389-197876411 TATTTTATGTAAAACTTGATAGG + Intronic
944343853 2:198636710-198636732 TGTTCAAAGTGGAACTTGAGTGG - Intergenic
945425910 2:209701644-209701666 TCTTTGATCTTGAACCTGAGGGG + Intronic
1170365562 20:15594447-15594469 TCTTTGATGTACACCTTGGGTGG + Intronic
1172369011 20:34372678-34372700 TGTTTAAAGTAGAACTTAAAAGG - Intronic
1173067754 20:39729284-39729306 TGTTGGATTTTGAACTTGTGTGG + Intergenic
1174981538 20:55400916-55400938 AGTTTTATGTAGAACTTTAGTGG - Intergenic
1175728956 20:61339811-61339833 TATCTGATGGAGAATTTGAGAGG + Intronic
1183387231 22:37521833-37521855 TTTCAGATGTAGAAGTTGAGAGG - Intergenic
949204839 3:1425467-1425489 TGTTTGATGATGTACTTGAGGGG + Intergenic
951484734 3:23199392-23199414 TGATACATGGAGAACTTGAGGGG + Intergenic
951670932 3:25181096-25181118 TGTTTGCTGTGGATATTGAGGGG + Intronic
951838694 3:27009894-27009916 AGTTTTATGTAGAATTTGATGGG + Intergenic
956473548 3:69594942-69594964 TGTTTGATCTAGACTTTGTGGGG + Intergenic
958649640 3:96922406-96922428 TGTGGGATGTAGACCTTGACTGG + Intronic
960455735 3:117869256-117869278 TATTTGAGGAAGAACTTAAGAGG + Intergenic
964833160 3:160908831-160908853 TGTTTGAGCTAAACCTTGAGTGG + Intronic
970471535 4:16384344-16384366 TAACTGATGTAGAACTTAAGTGG + Intergenic
971686134 4:29771008-29771030 TATCTGTTGTAGAACATGAGAGG + Intergenic
976768808 4:88628642-88628664 CATTTGCTGTAGAAATTGAGTGG + Intronic
976919558 4:90422134-90422156 TCTTTGTTGGAGAACTTGACAGG + Intronic
977392409 4:96428542-96428564 TGTTGGATTTAGAACTTGCTTGG - Intergenic
978401232 4:108333246-108333268 TGTATGATGTAGAACTTGAAGGG - Intergenic
983086081 4:163445906-163445928 TTTTTGATGCAAGACTTGAGGGG + Intergenic
983987012 4:174072139-174072161 GGTTGGATGTAGAAAATGAGAGG + Intergenic
984257444 4:177405527-177405549 TGTTTGAGGGAGAGCTTGAAAGG - Intergenic
986014746 5:3748056-3748078 TGTTGGATTTTGAACTTGTGTGG + Intergenic
987475653 5:18389324-18389346 TGTTTGATGCAGCAGCTGAGAGG - Intergenic
987637357 5:20561971-20561993 TATTTGATTTGGAACTTGTGAGG - Intronic
988057751 5:26122223-26122245 TTTTGGATGTAGAACTGGAGGGG + Intergenic
989414261 5:41155220-41155242 TTTTAGAAGTAGAAATTGAGAGG - Intronic
991600510 5:68347591-68347613 TGTTGGAGGTAGAGCTTGATGGG + Intergenic
991862655 5:71026383-71026405 TGTTTGATGTAGATTCTTAGTGG + Intergenic
993982124 5:94555555-94555577 TGTATGAAGTAGAAATTGACAGG + Intronic
995860635 5:116636767-116636789 TGTTGGATTTTGGACTTGAGTGG - Intergenic
996981642 5:129502921-129502943 TGTCTGGTGTAGAATTAGAGAGG + Intronic
1001003178 5:168026949-168026971 TATTTCATGTAGAAATTGGGAGG - Intronic
1003064618 6:2893361-2893383 AGTTTGATGAAGAAGTTGAATGG - Intronic
1004007889 6:11653647-11653669 TGCTTGAAGGAGAACTTAAGTGG + Intergenic
1005221089 6:23589784-23589806 TGACTGAAGGAGAACTTGAGGGG - Intergenic
1005780179 6:29182941-29182963 TGTTGGATGTAAATTTTGAGAGG + Intergenic
1006039114 6:31239039-31239061 TGTCTGATGAGGAACTGGAGAGG + Intergenic
1008161365 6:48080007-48080029 AGACTGATGTAGAAATTGAGAGG + Intergenic
1008914701 6:56774444-56774466 TGTTTGTTGCAGGACTTTAGAGG - Intronic
1009059437 6:58380542-58380564 TTTTTAATGAAGAACTGGAGAGG - Intergenic
1009504348 6:64456168-64456190 TGTTTGACATGGAATTTGAGTGG - Intronic
1010600367 6:77817860-77817882 TGTTGGATGTAAAATATGAGAGG - Intronic
1010985335 6:82416771-82416793 TGTTTGATGTAACTCTTTAGGGG + Intergenic
1011751902 6:90462097-90462119 TGTGTGAAATAGACCTTGAGTGG + Intergenic
1012971237 6:105733704-105733726 TGTTTTCTGTGGAACTTCAGAGG + Intergenic
1014333952 6:120107758-120107780 TGTTTTATGTGGGACTAGAGGGG - Intergenic
1020544107 7:9501541-9501563 TGTGTGAGGTAGAACTGAAGAGG + Intergenic
1023657886 7:42444435-42444457 TTTTTGATGTAGAATATTAGTGG + Intergenic
1024340043 7:48248119-48248141 TCTTTGATGTACAGTTTGAGTGG + Intronic
1028860125 7:95639856-95639878 TGTATGAGATAGAATTTGAGGGG + Intergenic
1031888997 7:127272674-127272696 TGTTTCAAGTAGAACCTTAGTGG - Intergenic
1033677688 7:143559580-143559602 TGTTTGAATTACAACTTGAAGGG + Intergenic
1033694147 7:143769860-143769882 TGTTTGAATTACAACTTGAAGGG - Intergenic
1036725198 8:11214388-11214410 TTTTTGATGTGCAACTTCAGAGG + Intergenic
1038895311 8:31776153-31776175 AGGTTGATGTGGAACTCGAGGGG + Intronic
1040393541 8:46972503-46972525 TGTTTGATGAGGAATTTGAGGGG + Intergenic
1041010733 8:53540248-53540270 TGTTTGATGAGGAATTTGAGGGG - Intergenic
1042699369 8:71595461-71595483 TGTTTGATGTAGGAAATGACAGG + Intergenic
1042822233 8:72942691-72942713 TCTTTCATTTAGAAATTGAGAGG - Intergenic
1048365093 8:133731459-133731481 TGATTAATTTATAACTTGAGAGG - Intergenic
1050438348 9:5632627-5632649 TGGTAGAGGTAGAACTTGACTGG + Intronic
1051409117 9:16770584-16770606 TGTTAGATGTAGAACTTCTCAGG - Intronic
1052702866 9:31959636-31959658 TGTTGGCTGGAGAACATGAGAGG - Intergenic
1055352879 9:75407510-75407532 TGGTTGATGTAGAACTACAAAGG + Intergenic
1186792059 X:13009153-13009175 TGTTCGAAGTTGAACTAGAGAGG + Intergenic
1187718344 X:22126699-22126721 TGTCTGATGTAGAACTCTATGGG + Intronic
1188532070 X:31152848-31152870 TTTTTGATGTTTAACTTGGGTGG + Intronic
1189455451 X:41184103-41184125 TGTTAGATATAGCACTTGTGAGG - Exonic
1197256424 X:124268398-124268420 AGTTTGATGTGAAACTTGAAGGG + Intronic
1198542821 X:137658296-137658318 GATTTGATGTGGAAGTTGAGAGG - Intergenic
1199420092 X:147635068-147635090 TATTTGATGGTGAACTTGTGAGG - Intergenic
1199807621 X:151316096-151316118 TATTTGATGTAGACCTTGAATGG - Intergenic
1201327986 Y:12786308-12786330 TGTTAGGTATAGAACTTGGGAGG - Exonic
1201402247 Y:13615724-13615746 TGGCAGATGTAGAACTTGACAGG + Intergenic