ID: 1080069512

View in Genome Browser
Species Human (GRCh38)
Location 11:28063570-28063592
Sequence GATAAGGTTTAGTAGGTTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 150}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080069512_1080069516 -1 Left 1080069512 11:28063570-28063592 CCTTAAACCTACTAAACCTTATC 0: 1
1: 0
2: 0
3: 14
4: 150
Right 1080069516 11:28063592-28063614 CTACAGAATATATCAGCGAAGGG 0: 1
1: 0
2: 0
3: 9
4: 126
1080069512_1080069515 -2 Left 1080069512 11:28063570-28063592 CCTTAAACCTACTAAACCTTATC 0: 1
1: 0
2: 0
3: 14
4: 150
Right 1080069515 11:28063591-28063613 TCTACAGAATATATCAGCGAAGG 0: 1
1: 0
2: 0
3: 7
4: 91
1080069512_1080069517 20 Left 1080069512 11:28063570-28063592 CCTTAAACCTACTAAACCTTATC 0: 1
1: 0
2: 0
3: 14
4: 150
Right 1080069517 11:28063613-28063635 GGATTACACCAAAGTATAAATGG 0: 1
1: 0
2: 0
3: 10
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080069512 Original CRISPR GATAAGGTTTAGTAGGTTTA AGG (reversed) Intronic
904985291 1:34542244-34542266 GATAATTTTTAATAGCTTTATGG - Intergenic
906630617 1:47364189-47364211 TCTAAGGTTTAGTAGTCTTATGG + Intronic
910228625 1:84963451-84963473 AATAAGATTTAGTAGGTATCAGG + Intronic
911367411 1:96955121-96955143 GATAAGGTATAGTATGTGTCTGG + Intergenic
913137168 1:115903039-115903061 TATTAGATTTAGTAGGATTAGGG + Intergenic
913432005 1:118805533-118805555 GATAGGGTTAATGAGGTTTAAGG + Intergenic
916967726 1:169969250-169969272 GAGAAGGTTTTATAGGGTTAGGG - Intronic
917499506 1:175573649-175573671 GATAAGCTTTGCCAGGTTTATGG - Intronic
917554688 1:176071357-176071379 GAAGAGGTTTAATTGGTTTACGG - Intronic
917785683 1:178454643-178454665 GATAAGGTAAAGTAGGTTGGTGG + Exonic
918843127 1:189570695-189570717 GAAAAGATTTTGTAGGTGTAAGG - Intergenic
919496974 1:198285060-198285082 GGTAAGGTTTAGGAGTTCTAGGG - Intronic
921693721 1:218183099-218183121 GAAAAGGTTTAATTGGTTCACGG + Intergenic
921917458 1:220628195-220628217 GATAAGGTTCAGTTGGTTACAGG - Intronic
922355203 1:224768873-224768895 GTTGATATTTAGTAGGTTTAGGG + Intergenic
922382137 1:225040857-225040879 GATGAGGATTAGTAAGCTTATGG - Intronic
923867127 1:237951480-237951502 GATAATGATTGGTAGGCTTAAGG + Intergenic
1065182450 10:23140214-23140236 GAGAAGATTTAGGAGGTTTTTGG + Intergenic
1065579013 10:27153077-27153099 GAAAGGGTTTAGCAGGTTGAAGG - Intronic
1067476524 10:46571022-46571044 GCTAAGGGGTAGTGGGTTTAGGG - Intergenic
1067618214 10:47770759-47770781 GCTAAGGGGTAGTGGGTTTAGGG + Intergenic
1068251343 10:54445565-54445587 GTTAAAGTTGAGTAGGGTTAAGG + Intronic
1071472921 10:85998132-85998154 AATAAGATCTAGTAGGTTAATGG - Intronic
1079317968 11:19425884-19425906 GATAACTTTTAGTAGATATATGG - Intronic
1080069512 11:28063570-28063592 GATAAGGTTTAGTAGGTTTAAGG - Intronic
1080331468 11:31144556-31144578 GATAAAGATTAGTGGATTTAAGG - Intronic
1080670294 11:34370373-34370395 GAAGAGGTTTAGTGGGATTAGGG + Intergenic
1083002482 11:59307452-59307474 GATAGGGTTTAGTAGCTTCTAGG - Intergenic
1089434934 11:118456907-118456929 GCTTAGGTTGATTAGGTTTATGG - Intronic
1089768162 11:120783529-120783551 TTTGAAGTTTAGTAGGTTTATGG + Intronic
1093045195 12:14435166-14435188 GATAAGGTTCTTTAGCTTTATGG + Intronic
1095826362 12:46533946-46533968 GATAAGGCTTAGAAGGTCAATGG + Intergenic
1099728516 12:86466290-86466312 GATGACCTTCAGTAGGTTTATGG + Intronic
1104156561 12:126138550-126138572 GATAAGGACTAGCAGGTATAAGG + Intergenic
1105759409 13:23499757-23499779 GATAAGGCTTAGAAGGTCTAGGG + Intergenic
1108215659 13:48181768-48181790 GATGAGATTTAGTAGGTCTCGGG - Intergenic
1109036848 13:57273976-57273998 GATAAGAAATAGTAAGTTTATGG + Intergenic
1109408044 13:61926217-61926239 TGTTAGGTTTAGTAGGTTTTTGG + Intergenic
1110078712 13:71284069-71284091 TATAAGGTTCATTTGGTTTATGG + Intergenic
1110574416 13:77039510-77039532 GATAATATTTTGTAGGTTTGTGG + Intergenic
1112084678 13:96017493-96017515 AAAGAGGTTTAGTTGGTTTATGG - Intronic
1112956205 13:105061063-105061085 TGTAAGGTTTAGAAAGTTTAGGG - Intergenic
1113723085 13:112575584-112575606 GATTAGGTTTAGTTGGTTGTTGG - Intronic
1118231218 14:63951652-63951674 TATAAGGTTATGTATGTTTATGG - Intronic
1119612800 14:76077932-76077954 GATTAGGGTTAGTAGGGTTAGGG - Intronic
1120935137 14:89888359-89888381 GACAAGGTTTAGATGGCTTATGG + Intronic
1122763101 14:104044348-104044370 GATTAGTTTTAGTAAATTTATGG - Intronic
1123206045 14:106714584-106714606 GACAGGGGTTATTAGGTTTAAGG - Intergenic
1123211130 14:106761994-106762016 GACAGGGTTTATTAGGTTTAAGG - Intergenic
1124153081 15:27199737-27199759 GAAAAGGTTTATTTGGTTTATGG - Intronic
1128896872 15:71382473-71382495 GATAAGATGTAGAAGGTTTGTGG - Intronic
1128914906 15:71550879-71550901 GATATGGTTCAGTAGTTTTTAGG - Intronic
1129803640 15:78436738-78436760 CAAAAGGAATAGTAGGTTTAAGG + Intergenic
1131424708 15:92336049-92336071 GAAAAGGTTTAGGCAGTTTAAGG - Intergenic
1134285772 16:12860894-12860916 TATCAGACTTAGTAGGTTTAGGG - Intergenic
1137474658 16:48797257-48797279 GAAAAGGTTTATTTGGCTTATGG + Intergenic
1137791172 16:51176042-51176064 GAAAAGGTTTATTTGGCTTATGG - Intergenic
1139316541 16:66075666-66075688 GATAATATTTAGTAAGTGTAAGG - Intergenic
1140642913 16:76998218-76998240 GATAATGTTTGCTAGGATTAGGG - Intergenic
1141180436 16:81749310-81749332 GAAAAAGTTTAGTTTGTTTAAGG - Intronic
1146981845 17:37170115-37170137 GAGCAGGTTTATTAGGTTTAGGG + Intronic
1148623567 17:49052616-49052638 GTTAAGGTTTAGTGGGATGAAGG + Exonic
1151256918 17:72884773-72884795 GAAAAGACTTAGTAGCTTTAAGG - Intronic
1151861683 17:76768526-76768548 GTTAAGGTTTTGTAGCATTAGGG + Intronic
1154243910 18:12678414-12678436 CATCAGGATTGGTAGGTTTATGG + Exonic
1157117999 18:44880551-44880573 GAAAAGGTTTAGTTGGCTAATGG + Intronic
1157211928 18:45750327-45750349 CATAAGGCTTAGTTGGTTTATGG - Exonic
1159293917 18:66456196-66456218 GATAAGGTTTTGGAGGTTTTAGG - Intergenic
1163341304 19:16709041-16709063 GATAAGGTTATATTGGTTTAGGG + Intergenic
1165645037 19:37428573-37428595 GCAAATGTTTAGTAAGTTTAAGG + Intronic
1166382827 19:42363644-42363666 GAAAAGGTTTGGGAGGTTGAAGG - Intronic
928909613 2:36406302-36406324 TATAAGGTTTATGAAGTTTAAGG + Intronic
932169883 2:69544737-69544759 GCTCTGGTTTAGTAGGGTTATGG - Intronic
932287622 2:70550195-70550217 GATAAGCTTTATTATTTTTATGG - Intronic
934147640 2:89111157-89111179 GGCAAGGTTTAATAGGTTTGTGG + Intergenic
934221632 2:90089444-90089466 GGCAAGGTTTAGTAGGTTTGTGG - Intergenic
934232156 2:90193788-90193810 GGCAAGGTTTAATAGGTTTGTGG - Intergenic
934611405 2:95739626-95739648 GATCAGGTTGATTAGGTTTGTGG + Intergenic
934876531 2:97925699-97925721 GATAAGGAAAATTAGGTTTATGG - Intronic
936675129 2:114706001-114706023 GTCATTGTTTAGTAGGTTTATGG + Intronic
938411667 2:131069834-131069856 GATGAGGGTTAGTCGTTTTATGG - Intronic
939759254 2:146154009-146154031 AATGAGGTTTAGAAGGTTCATGG + Intergenic
940292709 2:152093185-152093207 GATAATTTTTATTAGATTTAGGG + Intronic
941043364 2:160647849-160647871 CATACGGTTTATTAGGTTTTTGG + Intergenic
941613767 2:167695032-167695054 GATAAGGTAGAGAAGGTTTTGGG - Intergenic
945667938 2:212765234-212765256 CATAAGGTTAAGGAGGCTTAGGG + Intergenic
948250640 2:236526020-236526042 TATAAGGTTCAATAGGTTTCAGG + Intergenic
1168843641 20:926677-926699 GATTTGGTTTAGTAAGTGTAGGG + Intergenic
1170258362 20:14373037-14373059 GAGAGTCTTTAGTAGGTTTAAGG - Intronic
1172108820 20:32533364-32533386 CATCAGATTTGGTAGGTTTAAGG - Intronic
1176952302 21:15063247-15063269 GATAGGGTTTATTTGGTTCAGGG - Intronic
1176992060 21:15508844-15508866 GAGAAGATTGAGTATGTTTATGG + Intergenic
1178935479 21:36858176-36858198 GATAAGATTTCTTAAGTTTAAGG - Intronic
1183869072 22:40727300-40727322 CAAAAGGATTACTAGGTTTAAGG - Intergenic
949777089 3:7645601-7645623 AATTAGGTTTGGTGGGTTTAGGG - Intronic
952338168 3:32422771-32422793 TATAATGTTTGGTAGGTTGAGGG - Intronic
952577791 3:34795475-34795497 GAAAAGGTTTGGTAAGTGTATGG + Intergenic
953270319 3:41436247-41436269 TATGATGTTTGGTAGGTTTAGGG + Intronic
954909727 3:54093725-54093747 GTAAAGGTTTAGAAGGTTTTTGG + Intergenic
957814300 3:85273147-85273169 GATCATGCTTAGTATGTTTAAGG + Intronic
957914314 3:86667105-86667127 AAAAAGGTTTAGTTGGTTCATGG - Intergenic
958689829 3:97449764-97449786 GATAAGATTTAGTAGGATGGTGG - Intronic
966072893 3:175900953-175900975 GATAAGCTTTGGTAGTTTCAAGG + Intergenic
966567748 3:181402226-181402248 TATAAGGTATAGCAGGTATAAGG - Intergenic
970344302 4:15138175-15138197 AAAGAGGTTTAGTTGGTTTATGG - Intergenic
973123973 4:46560450-46560472 AATAAGGTTTTGTAGCTGTACGG + Intergenic
973626945 4:52782177-52782199 GATGGGTTTTAATAGGTTTAAGG + Intergenic
973804989 4:54516915-54516937 GAGAAGGTTGAGTAGGTTCGAGG - Intergenic
975074241 4:70185102-70185124 AAAAAGCTTTAGTAGGATTAAGG + Intergenic
979695873 4:123612361-123612383 AATAAAGTTTTGTAGTTTTAAGG - Intergenic
980304336 4:131037885-131037907 GGTGAGATTTAGTAAGTTTAGGG - Intergenic
980471135 4:133253309-133253331 GATAAGGGTTATTAGGTCCAGGG + Intergenic
981232794 4:142377953-142377975 GATAAGATTTAGCAGTTTGACGG - Intronic
982032339 4:151313123-151313145 GATATGATGTAGTAGGTTTTGGG - Intronic
982716790 4:158817343-158817365 GATTATGTTTAGCAGGTTTAAGG + Intronic
982981457 4:162141551-162141573 AATAAGGTTTATTTGGCTTACGG - Intronic
983408711 4:167368118-167368140 GATAATGTTCAAAAGGTTTAAGG - Intergenic
983561775 4:169108838-169108860 TCTAAGCTTTAGTAGGTGTAGGG - Intronic
987610744 5:20199348-20199370 GATAATGTTTTGGAAGTTTAGGG + Intronic
989304925 5:39943293-39943315 AATAGGTGTTAGTAGGTTTAGGG - Intergenic
993321219 5:86469914-86469936 GATAAGGTTTATGTGGTTTCTGG - Intergenic
993775971 5:91996383-91996405 GATAAAGTTAACTAGGTTTTTGG + Intergenic
994095947 5:95847770-95847792 GATATGTTTTATTAGGTTTGTGG - Intergenic
994383345 5:99098141-99098163 GATAAGGTATGGTATCTTTACGG + Intergenic
1003351006 6:5317828-5317850 GACAAGGTTTAGTAGGCTTGTGG + Intronic
1004999559 6:21227103-21227125 GATAAGGTTTTAAAGGTTTAGGG + Intronic
1005765694 6:29009625-29009647 GATAATGTTAAGTAATTTTATGG + Intergenic
1008064357 6:47031675-47031697 TCCAAGATTTAGTAGGTTTAGGG - Intronic
1009901796 6:69816267-69816289 GCTCAGGTTAAGTAGGGTTAGGG + Intergenic
1012589655 6:100965266-100965288 GCTAATTTTTAATAGGTTTAAGG + Intergenic
1013951457 6:115787437-115787459 GGTAAAGTTGAGTAGGTTGATGG - Intergenic
1014991348 6:128081740-128081762 TATAAACTTTAGTAGATTTAGGG + Intronic
1021956026 7:25825269-25825291 GTTAAGAATTAGTAAGTTTAGGG + Intergenic
1022582528 7:31570323-31570345 GATCTGGTTCAGTAGGTCTAGGG - Intronic
1024120252 7:46229538-46229560 GATATGGTTGAGGAGGCTTATGG + Intergenic
1024761856 7:52607613-52607635 AATAAAGTTTAATATGTTTAGGG - Intergenic
1025091696 7:56069543-56069565 GGTATGGTTTAGTAAGTTTCAGG - Intronic
1027410023 7:77906288-77906310 GTTAAGGTTTAGAAGATATATGG - Intronic
1028331162 7:89593913-89593935 TACAAGGTTTAGTAGCTTTGAGG + Intergenic
1029813710 7:103074015-103074037 CATTAGGTTTTGTAGGTTTGGGG - Intronic
1030177443 7:106669524-106669546 TATCAGGTTTAGTAGGTTAGGGG - Intergenic
1030690165 7:112524195-112524217 AATCAGATTTAGTAGGTCTAGGG + Intergenic
1030763146 7:113376282-113376304 GATAGGTTATAGTAAGTTTATGG - Intergenic
1036038963 8:5053004-5053026 GAAAACGTTTAGTAGGATTTTGG - Intergenic
1041764766 8:61406959-61406981 GACAAGATTCAGTAGTTTTAAGG + Intronic
1042414522 8:68503966-68503988 TATATGGTTTAGTAGTTTTTAGG + Intronic
1043448946 8:80347497-80347519 GAAGAGGTTTTGTAAGTTTAAGG + Intergenic
1043509227 8:80933127-80933149 GATAAGCTTTTGTAGATTTAGGG + Intergenic
1045132650 8:99173616-99173638 TTTAAGGCTTAGTAGTTTTAAGG - Intronic
1045304015 8:100941277-100941299 GACAATGTTTATTACGTTTAAGG + Intronic
1046991670 8:120464213-120464235 GATGATGTTTAGGAGATTTATGG + Intronic
1047135823 8:122077166-122077188 GAAAAAATTTAGTAGGTTTAGGG + Intergenic
1051180626 9:14408060-14408082 GAAAAGGTTTAGTTAGTTTCAGG + Intergenic
1052118751 9:24681950-24681972 GAAGATGTTTGGTAGGTTTATGG + Intergenic
1052549666 9:29931930-29931952 GAAAAGGTTTAATTGGCTTACGG + Intergenic
1058523077 9:105831394-105831416 AATAAGGTTTAGTTGGCTCATGG + Intergenic
1185725129 X:2413846-2413868 GATGAGGTCTAGTTGGGTTAGGG - Intronic
1185725281 X:2415620-2415642 GATGAGGTCTAGTTGGGTTAGGG - Intronic
1187144821 X:16627820-16627842 GAAAAGGTTTTGCAGGTTTCGGG - Intronic
1194006498 X:88500102-88500124 CAAAAGGTTTACTAAGTTTATGG - Intergenic
1194592974 X:95822745-95822767 GATAATTTTTAGTATGTTTATGG + Intergenic
1195165911 X:102220309-102220331 GGTAAGGTTTTGTGGGTGTAAGG + Intronic
1195192948 X:102466782-102466804 GGTAAGGTTTTGTGGGTGTAAGG - Intronic
1197240560 X:124118674-124118696 GATAAGGTATAATAGGCTTGTGG + Intronic
1197407680 X:126072897-126072919 TATAAGTTTTAGGTGGTTTATGG - Intergenic