ID: 1080074591

View in Genome Browser
Species Human (GRCh38)
Location 11:28134371-28134393
Sequence ATACGCACGGGGGAATGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 98}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080074591_1080074604 10 Left 1080074591 11:28134371-28134393 CCACCCCATTCCCCCGTGCGTAT 0: 1
1: 0
2: 1
3: 7
4: 98
Right 1080074604 11:28134404-28134426 AGTTGGCGGTGGACATATTTAGG 0: 1
1: 0
2: 0
3: 7
4: 117
1080074591_1080074605 15 Left 1080074591 11:28134371-28134393 CCACCCCATTCCCCCGTGCGTAT 0: 1
1: 0
2: 1
3: 7
4: 98
Right 1080074605 11:28134409-28134431 GCGGTGGACATATTTAGGCAAGG 0: 1
1: 0
2: 0
3: 2
4: 43
1080074591_1080074601 -7 Left 1080074591 11:28134371-28134393 CCACCCCATTCCCCCGTGCGTAT 0: 1
1: 0
2: 1
3: 7
4: 98
Right 1080074601 11:28134387-28134409 TGCGTATGTGGGCTCTTAGTTGG 0: 1
1: 0
2: 0
3: 33
4: 863
1080074591_1080074602 -4 Left 1080074591 11:28134371-28134393 CCACCCCATTCCCCCGTGCGTAT 0: 1
1: 0
2: 1
3: 7
4: 98
Right 1080074602 11:28134390-28134412 GTATGTGGGCTCTTAGTTGGCGG 0: 1
1: 0
2: 0
3: 2
4: 92
1080074591_1080074603 -1 Left 1080074591 11:28134371-28134393 CCACCCCATTCCCCCGTGCGTAT 0: 1
1: 0
2: 1
3: 7
4: 98
Right 1080074603 11:28134393-28134415 TGTGGGCTCTTAGTTGGCGGTGG 0: 1
1: 0
2: 0
3: 4
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080074591 Original CRISPR ATACGCACGGGGGAATGGGG TGG (reversed) Intronic
900009583 1:94089-94111 TTACGAGCTGGGGAATGGGGAGG - Intergenic
900025693 1:270666-270688 TTACGAGCTGGGGAATGGGGAGG - Intergenic
900035458 1:404428-404450 TTACGAGCTGGGGAATGGGGAGG - Intergenic
900057079 1:640178-640200 TTACGAGCTGGGGAATGGGGAGG - Intergenic
901244108 1:7715164-7715186 AGAGGCCCGGGGGAATGGGCTGG + Intronic
902705244 1:18199893-18199915 ATTCTCACGGGGGTAGGGGGGGG - Intronic
903293388 1:22328806-22328828 AGATGGACGGGGGAAGGGGGAGG + Intergenic
904895255 1:33812456-33812478 ATATACATGGGGGAATGGAGTGG - Intronic
908208329 1:61873816-61873838 ATGCACTGGGGGGAATGGGGTGG + Intronic
913261386 1:117000996-117001018 ATAGGGTCGGGGGAAGGGGGAGG + Intergenic
913327395 1:117638766-117638788 ACACTCCCTGGGGAATGGGGAGG + Intergenic
921067105 1:211630885-211630907 AGAGGCATTGGGGAATGGGGAGG + Intergenic
922257996 1:223909983-223910005 TTACGAGCTGGGGAATGGGGAGG - Intergenic
924339191 1:243012762-243012784 TTACGAGCTGGGGAATGGGGAGG - Intergenic
1062838988 10:655096-655118 ATACACATGGGGGAATGGGGTGG + Intronic
1063443330 10:6090607-6090629 ATAGGCAGGGGAGAATGGGAAGG - Intronic
1066102763 10:32132560-32132582 ATGCGCACTGGGGGATGGGGCGG - Intergenic
1073572384 10:104591546-104591568 ATTTGAAAGGGGGAATGGGGTGG + Intergenic
1075874919 10:125798190-125798212 CTGTGCACAGGGGAATGGGGAGG + Intronic
1077722635 11:4643737-4643759 ATATGCCTGGGGGTATGGGGAGG - Exonic
1078133934 11:8636891-8636913 AGATGCACTGGGGAATGGGATGG - Intronic
1079503787 11:21132241-21132263 ACACACACAGGGCAATGGGGAGG + Intronic
1080074591 11:28134371-28134393 ATACGCACGGGGGAATGGGGTGG - Intronic
1087177194 11:95106822-95106844 ATGCTGACGGGGGAAAGGGGGGG - Intronic
1092203958 12:6604473-6604495 ATTCCCAAGGGGGAATGGGAGGG - Intronic
1107200043 13:37704194-37704216 TTGCCTACGGGGGAATGGGGAGG + Intronic
1109711454 13:66165513-66165535 ATACGGAAGGGGGAAGGGCGTGG - Intergenic
1110412535 13:75220145-75220167 AAACGCAGTGGGGAGTGGGGAGG + Intergenic
1120731191 14:88003100-88003122 CTACTCATGGGGTAATGGGGAGG - Intergenic
1121467151 14:94123277-94123299 ACACCAACAGGGGAATGGGGAGG + Intergenic
1122878902 14:104681176-104681198 ATATGCAGGAGGAAATGGGGCGG + Intergenic
1123462295 15:20484157-20484179 CTACCTACGGGGAAATGGGGAGG + Intergenic
1123655764 15:22516237-22516259 CTACCTACGGGGAAATGGGGAGG - Intergenic
1124272984 15:28300155-28300177 CTACCTACGGGGAAATGGGGAGG + Intronic
1124309674 15:28611414-28611436 CTACCTACGGGGAAATGGGGAGG - Intergenic
1124559599 15:30759406-30759428 GGGGGCACGGGGGAATGGGGAGG - Intronic
1124671652 15:31646300-31646322 GGGGGCACGGGGGAATGGGGAGG + Intronic
1128126196 15:65194870-65194892 AAACTCACGGGGGGAGGGGGAGG - Exonic
1128470284 15:67946061-67946083 CAACGCACAGGGGAATGTGGTGG - Intergenic
1135550891 16:23397477-23397499 ATTCCCAGGGGTGAATGGGGAGG + Intronic
1137384579 16:48029774-48029796 AGAGGCACGGGGGAAGGAGGAGG + Intergenic
1142454746 16:90212813-90212835 TTACGAGCTGGGGAATGGGGAGG + Intergenic
1144666448 17:17105432-17105454 AGGAGCACGGGGGAATGGAGGGG - Intronic
1151176545 17:72293344-72293366 ATAGGCAAGGGGACATGGGGAGG - Intergenic
1163322726 19:16583996-16584018 ACACGCATGGGGGCATGGAGGGG + Intronic
1164601555 19:29566596-29566618 ATAGGCACAGGGGAATGGGCAGG + Intergenic
1164601728 19:29567253-29567275 ATAGGCACAGGGGAGTGGGCAGG + Intergenic
1164922553 19:32100050-32100072 ATAGGAACTGGGGAATGGTGAGG - Intergenic
925668769 2:6289971-6289993 ATTGGCTCGGGGGAGTGGGGAGG - Intergenic
928395735 2:30942140-30942162 ATACACCCTGGGGATTGGGGCGG - Intronic
936251270 2:110870041-110870063 AAACCCATGGGGGAGTGGGGAGG + Intronic
937084400 2:119161112-119161134 ATATGCAGGGTGGCATGGGGAGG + Intergenic
938078938 2:128359002-128359024 AGAAGCCCTGGGGAATGGGGAGG + Intergenic
942060582 2:172225312-172225334 ATAAGGACTGGGGGATGGGGAGG - Intergenic
949086207 2:242157472-242157494 TTACGAGCTGGGGAATGGGGAGG + Intergenic
1174177773 20:48655957-48655979 ATCTGCAGGGGGGAATGGGAGGG - Intronic
1175369334 20:58476773-58476795 AAAAGCACGGTGGGATGGGGTGG - Intronic
1175987292 20:62770446-62770468 ATGCGCACGGGTGAATATGGAGG + Intergenic
1176982681 21:15401197-15401219 ATACCCACTGTGCAATGGGGAGG - Intergenic
1179987493 21:44929796-44929818 ACAGGCACGTGGGAATGGTGCGG + Intronic
1181110988 22:20602886-20602908 AGTGGCACGGGGGCATGGGGTGG + Intergenic
1183352959 22:37343996-37344018 ATAGGCAGGGGGGCATGGGCAGG - Intergenic
1184792547 22:46708935-46708957 AGACCCACTGGGGAATGGGCAGG - Intronic
1184796369 22:46735714-46735736 ATACACCTGGGGGAATGGGGAGG + Intronic
1185262225 22:49873899-49873921 ATAAGGGCTGGGGAATGGGGCGG + Intronic
954378091 3:50205372-50205394 ACCCGCACAGGGGAATCGGGTGG + Intronic
955130768 3:56165462-56165484 ATATGCAGGGGGGAGGGGGGAGG - Intronic
959566077 3:107834497-107834519 AGAAGCAGGGGGGAATGGGGTGG + Intergenic
961009086 3:123424147-123424169 ACACGCACGTGGGACTGTGGGGG + Intronic
961222214 3:125210305-125210327 ATAAGCTCTGGGGAATGGTGTGG + Intronic
962231377 3:133668553-133668575 CTACACACTGGGGAATGGGGAGG - Intergenic
977499283 4:97818711-97818733 ATATGCAGGGTGGAGTGGGGAGG - Intronic
979237930 4:118422460-118422482 TTACGAGCTGGGGAATGGGGAGG + Intergenic
984172746 4:176380707-176380729 GTGCACACGGGGGAGTGGGGCGG + Intergenic
984583624 4:181537960-181537982 ATACGTTAGGGGGAATGGGAAGG + Intergenic
985131211 4:186740439-186740461 ATTAGCAGAGGGGAATGGGGAGG + Intergenic
992901587 5:81301953-81301975 CTACGTACGTGGGAAGGGGGAGG - Exonic
996735651 5:126755858-126755880 GGACACACGGGGGAGTGGGGAGG - Intergenic
999149638 5:149418168-149418190 ATTCACACCGAGGAATGGGGTGG + Intergenic
1002061796 5:176629805-176629827 CTTCGCACTGGGGAGTGGGGTGG - Exonic
1002738361 5:181414443-181414465 TTACGAGCTGGGGAATGGGGAGG + Intergenic
1004326280 6:14676768-14676790 ACGCGCAAGGGGGAATGGAGTGG - Intergenic
1011205848 6:84896279-84896301 AAAAGCATTGGGGAATGGGGTGG + Intergenic
1015020251 6:128464699-128464721 GTACTCACGGGGGAATGTGCTGG - Intronic
1019243463 6:170689995-170690017 TTACGAGCTGGGGAATGGGGAGG + Intergenic
1022924304 7:35044430-35044452 AGAGGCACTGGGGAATGGTGAGG - Intergenic
1022924421 7:35044850-35044872 AGAAGCACTGGGGAATGGTGAGG - Intergenic
1022924445 7:35044930-35044952 AGAAGCACTGGGGAATGGTGAGG - Intergenic
1022924486 7:35045110-35045132 AGAGGCACTGGGGAATGGTGAGG - Intergenic
1022924497 7:35045150-35045172 AGAGGCACTGGGGAATGGTGAGG - Intergenic
1022924516 7:35045210-35045232 AGAAGCACTGGGGAATGGTGAGG - Intergenic
1022924527 7:35045250-35045272 AGAAGCACTGGGGAATGGTGAGG - Intergenic
1022924537 7:35045290-35045312 AGAAGCACTGGGGAATGGTGAGG - Intergenic
1022924712 7:35045870-35045892 AGAAGCACTGGGGAATGGTGAGG - Intergenic
1023620418 7:42066296-42066318 ATACACTCGGGGGAAGGGGGTGG + Intronic
1026257271 7:68723559-68723581 ATGTGCAGGGTGGAATGGGGAGG + Intergenic
1032008103 7:128320452-128320474 ATACGCAAAGGGGAATGTGGAGG + Intronic
1035029956 7:155850296-155850318 CTCCCCATGGGGGAATGGGGTGG + Intergenic
1035504659 8:118163-118185 TTACGAGCTGGGGAATGGGGAGG - Intergenic
1041007249 8:53507665-53507687 ATATGCACAGGGTTATGGGGAGG - Intergenic
1046775474 8:118159240-118159262 GTGCGCACTGGGGAATGTGGTGG - Intergenic
1059135619 9:111803454-111803476 ATATGTAAGGGGGAAAGGGGTGG + Intergenic
1061273746 9:129558119-129558141 GTATGCACGTGGGAATGGTGGGG - Intergenic
1203603652 Un_KI270748v1:39218-39240 TTACGAGCTGGGGAATGGGGAGG + Intergenic
1196766593 X:119251445-119251467 CTGAGCACAGGGGAATGGGGAGG - Intergenic
1202385717 Y:24324261-24324283 TTACGAGCTGGGGAATGGGGAGG + Intergenic
1202485069 Y:25345867-25345889 TTACGAGCTGGGGAATGGGGAGG - Intergenic