ID: 1080085149

View in Genome Browser
Species Human (GRCh38)
Location 11:28271368-28271390
Sequence TCCAGGAAACCTACTTAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 88}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080085149 Original CRISPR TCCAGGAAACCTACTTAGGT TGG Intronic
902682455 1:18053156-18053178 TCCAGGGAACCCACTCTGGTGGG - Intergenic
909352103 1:74665922-74665944 TCCATGATATATACTTAGGTTGG - Intronic
910944466 1:92574872-92574894 TCTTGGAAACTTTCTTAGGTAGG + Intronic
912645922 1:111391633-111391655 TCCAGGAGACCTACAGAGGAAGG + Intergenic
915356328 1:155257058-155257080 TCCAGGAAGCCACCTTAGATTGG + Intronic
923938726 1:238795012-238795034 TCCAGGCAACCTAGTCATGTAGG + Intergenic
924061287 1:240177433-240177455 CCCAGGAAACCGACTTATCTGGG - Intronic
1063634497 10:7768719-7768741 TAAAAGAAACCTATTTAGGTGGG + Intronic
1063833073 10:9978900-9978922 TTCAGGTAACCTTCTTTGGTTGG + Intergenic
1071520855 10:86330744-86330766 GCCAGGAAACCTACTTCCCTCGG - Intronic
1073760691 10:106625476-106625498 TCCAGGAATCCTAATTCAGTGGG + Intronic
1080085149 11:28271368-28271390 TCCAGGAAACCTACTTAGGTTGG + Intronic
1081411406 11:42762667-42762689 TCCAAAAAACCTCCTTAGGCAGG + Intergenic
1086367763 11:86125173-86125195 TTCAAGATACCTATTTAGGTTGG + Intergenic
1092459859 12:8676820-8676842 TACAGGAAACCGACTCAGGAAGG + Intergenic
1097989233 12:65817758-65817780 TCCAGGAATCGCACTTAGCTAGG - Intergenic
1098828457 12:75329862-75329884 TCCAGGAATCCCAGTTAGGTAGG - Exonic
1098948865 12:76618492-76618514 TCCAGAAGTCCTACTTAGGTTGG + Intergenic
1099391724 12:82088916-82088938 TACAGGAAAGCTACTTAGTTTGG + Intergenic
1100616940 12:96238121-96238143 TCCAGGAAAATTTCTTGGGTGGG - Intronic
1101217713 12:102601377-102601399 TCCAGGAAATTTAGTTTGGTTGG + Intergenic
1104385548 12:128348619-128348641 TCCAGGAAAACTAGGTTGGTTGG - Intronic
1104994870 12:132647967-132647989 TCCAGAAAACCTCCTTGTGTAGG + Intronic
1110316826 13:74117999-74118021 ACCAGGAAACCAACATTGGTAGG - Intronic
1112339901 13:98544361-98544383 TCCAGGAAACCTTCCTGGTTAGG - Intronic
1113255957 13:108505169-108505191 TCCAGGAATCCTACTTCTTTGGG - Intergenic
1117575034 14:57089020-57089042 TCTAGGGAACACACTTAGGTTGG + Intergenic
1118427838 14:65686459-65686481 TTCCTGAAAGCTACTTAGGTAGG + Intronic
1120943142 14:89968489-89968511 TCCAGGAAGGCTGCTTAGATGGG - Intronic
1124576921 15:30917721-30917743 TCCAGGTAATCTTCTTAGCTTGG + Intronic
1126407533 15:48336774-48336796 TCTAGCACACCTACTTATGTGGG - Intronic
1127842867 15:62845799-62845821 TGCAGGAACCGCACTTAGGTAGG + Intergenic
1128368787 15:67024095-67024117 TCCAGGAAACAGACCCAGGTAGG + Intergenic
1133475268 16:6115226-6115248 TACAAGAATCCTAGTTAGGTAGG - Intronic
1135044891 16:19147064-19147086 TCCAAGAACCATACTTTGGTTGG + Intronic
1139962290 16:70724944-70724966 TCTAGCAAACAGACTTAGGTTGG + Intronic
1142716006 17:1747314-1747336 TCCAGGAAATCTTCTTTGATGGG - Exonic
1144375338 17:14634471-14634493 TCCAGTAAACCAATTTAGGTTGG - Intergenic
1148505174 17:48121548-48121570 GCCAGGAGACTTACTCAGGTGGG + Exonic
1154114379 18:11598267-11598289 TCCAGGAACCCTACCAGGGTAGG + Intergenic
1156632264 18:38984360-38984382 TACAGGAAGCCTGGTTAGGTAGG - Intergenic
1158941594 18:62410125-62410147 TCCTGGAAACCTACTGAGACTGG + Intergenic
1164796623 19:31039034-31039056 TCCATGAAACCTCCTGAGCTTGG + Intergenic
932436643 2:71705816-71705838 TCCAGGACAGACACTTAGGTGGG - Intergenic
937044570 2:118844358-118844380 CACAGGAAACCTCCTTAGGAAGG + Intronic
937252298 2:120532617-120532639 ACCAGGAAACCAACGTGGGTAGG + Intergenic
937353658 2:121184793-121184815 TCCAGGACTCAGACTTAGGTGGG - Intergenic
942071962 2:172324386-172324408 TCCAGGAAACAGACTCAGGGAGG + Intergenic
942795731 2:179816535-179816557 CCCAGGAAGCCTAATCAGGTAGG - Intronic
943336508 2:186621858-186621880 TCCAGGAAACTTGATTTGGTTGG - Intronic
946995436 2:225385223-225385245 TCCAGGGAACATGGTTAGGTAGG - Intergenic
1169976940 20:11339878-11339900 TCCAGGAAACAAATCTAGGTGGG - Intergenic
1170095936 20:12646132-12646154 TCAAGTAAAACTGCTTAGGTTGG + Intergenic
1172416026 20:34768749-34768771 TTCATGAAACCTGCTTAGATGGG - Intronic
1173248891 20:41354210-41354232 CCCAGGCAACCTCCTAAGGTTGG - Intronic
1173440200 20:43068659-43068681 TGCAGGAATCATACTTAGGGAGG + Intronic
1174867552 20:54152037-54152059 TCCAGGCAACCTGCTCAGGGAGG + Intergenic
1178029606 21:28509111-28509133 TCCGGATAAACTACTTAGGTGGG + Intergenic
1183624678 22:38994374-38994396 TCCCGGAAACGCACTGAGGTTGG + Intergenic
949694536 3:6679469-6679491 ACCAGGAAACCTAATCATGTGGG - Intergenic
950127839 3:10521186-10521208 GGCAGGAAACCCACTAAGGTGGG - Intronic
950579580 3:13853587-13853609 TCCAGGAAGCCCACTGAGATTGG + Intronic
953607465 3:44420986-44421008 GCCAGGAGACCTCCTTGGGTGGG - Intergenic
954406459 3:50348010-50348032 TCCAGGAAGCCTGCTTGGATTGG + Intronic
959611176 3:108296255-108296277 TACAGGCAACCTCCTGAGGTTGG - Intergenic
966960636 3:184934548-184934570 TACAGTAAACATACTTATGTTGG - Intronic
971435899 4:26623104-26623126 TCCATGAAAGCTACCTAGTTTGG + Intronic
974392737 4:61293826-61293848 TCCAGGTAACATAATTAGGAAGG - Intronic
978221784 4:106285758-106285780 AACAGGAAACCTATTTAGATGGG - Intronic
982230740 4:153206117-153206139 TGTGGGACACCTACTTAGGTGGG - Intronic
984481272 4:180306150-180306172 TACAGAAAACATACTTATGTAGG + Intergenic
991611728 5:68456481-68456503 TCCAGGAAACCCCCTCAGATGGG + Intergenic
992131358 5:73695963-73695985 TCCAGGAATGCCACTAAGGTAGG + Intronic
1003943938 6:11056434-11056456 TCCAGGAAACTTACATATGTTGG + Intergenic
1005746932 6:28846911-28846933 TCCAGCAAACCTACTTCTGCAGG + Intergenic
1007343424 6:41208755-41208777 TCCTGGAGACCTGCTGAGGTGGG + Intergenic
1007346887 6:41237431-41237453 TCCTGGAGACCTGCTGAGGTGGG - Exonic
1007922654 6:45624794-45624816 TCCAAGTAACCCACTGAGGTAGG + Intronic
1014646011 6:123973637-123973659 TCCTGGAATACTATTTAGGTTGG + Intronic
1015173971 6:130286283-130286305 TCAAGGAAACCAATTAAGGTAGG + Intronic
1015221195 6:130805422-130805444 TCCAGAAAACTTTATTAGGTTGG - Intergenic
1015493012 6:133849887-133849909 TTCAGAAAACTTACTTTGGTAGG - Intergenic
1021291587 7:18851849-18851871 TTCAGGAAACCAACTTTGATTGG - Intronic
1021847725 7:24778968-24778990 TCCAGGAAGACCACTTAGGAGGG - Intergenic
1024836049 7:53519975-53519997 TCCAGGAAACAACCTTATGTGGG - Intergenic
1030735941 7:113048766-113048788 TCCAGGAATCCTACATAAATTGG + Intergenic
1032666796 7:134044897-134044919 TCCAGGAAAACTGCTGAGTTAGG - Intronic
1039995638 8:42530353-42530375 TTCAGGAAATATACTCAGGTTGG + Intronic
1040578367 8:48674334-48674356 CCCTGGAATCCTACTTATGTTGG + Intergenic
1044836224 8:96297993-96298015 TCCAGGAAAGTTCCTTAGGCTGG + Intronic
1051742980 9:20269143-20269165 TCCTGCACACCAACTTAGGTGGG - Intergenic
1052354547 9:27490713-27490735 GTCAAGAAACCTAATTAGGTGGG - Intronic
1189169022 X:38891215-38891237 TATAGGAAACCTACCTAGGTTGG + Intergenic
1190894611 X:54604845-54604867 TCCAAGTAACCTATTTAGGTTGG - Intergenic
1195340981 X:103905805-103905827 TCAAGGCAACCTTCTTAGGGAGG + Intergenic
1196104105 X:111877794-111877816 TACAGCCAACCTACATAGGTAGG - Intronic