ID: 1080087339

View in Genome Browser
Species Human (GRCh38)
Location 11:28300067-28300089
Sequence CTAGGTCAGATCACATTTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 175}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080087336_1080087339 16 Left 1080087336 11:28300028-28300050 CCTAATCTTAACTTGATTATATC 0: 1
1: 21
2: 189
3: 395
4: 957
Right 1080087339 11:28300067-28300089 CTAGGTCAGATCACATTTATAGG 0: 1
1: 0
2: 1
3: 9
4: 175
1080087335_1080087339 25 Left 1080087335 11:28300019-28300041 CCAGTATATCCTAATCTTAACTT 0: 1
1: 0
2: 14
3: 120
4: 677
Right 1080087339 11:28300067-28300089 CTAGGTCAGATCACATTTATAGG 0: 1
1: 0
2: 1
3: 9
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080087339 Original CRISPR CTAGGTCAGATCACATTTAT AGG Intronic
901662861 1:10809610-10809632 CCAGCTCAGATCAAATTTAAAGG - Intergenic
902913225 1:19616886-19616908 TAAAGACAGATCACATTTATGGG - Intronic
906232394 1:44175516-44175538 CTAAGTCATATCAGAATTATAGG + Intergenic
906563026 1:46773753-46773775 CTAAGTCATATCAGAATTATAGG - Intronic
909156890 1:72089606-72089628 CTGGGTCAAATCACATATCTTGG + Intronic
909429917 1:75575723-75575745 CAAGGTCAGCTCAGATTTTTTGG - Intronic
911212409 1:95156282-95156304 CTAGGTCAGAAAACATTTTGAGG + Intronic
917293808 1:173497848-173497870 CTAAGTCATATCAGAATTATAGG - Intergenic
918460902 1:184775467-184775489 CAAGGTAAGATCACATTTATAGG - Intergenic
921591742 1:217012106-217012128 CTAGGTCACCTCACTTTCATGGG - Intronic
921664652 1:217854024-217854046 CATGGTCAGAACAAATTTATAGG + Intronic
922527373 1:226315571-226315593 CATGGTCAGAACAAATTTATAGG - Intergenic
924522678 1:244818766-244818788 CTAAGTCATATCAGAATTATAGG - Intergenic
1063245828 10:4217490-4217512 CTGGATCACATCACATTTCTGGG + Intergenic
1063522097 10:6750408-6750430 CAAGGACAGATAACATTTAAAGG + Intergenic
1065191334 10:23211997-23212019 CTAAATAAGCTCACATTTATAGG - Intronic
1065384570 10:25121859-25121881 CTAAGTCATACCAGATTTATAGG - Intergenic
1068515078 10:58015817-58015839 TAAGGTCAGATAAAATTTATTGG - Intergenic
1068753866 10:60628205-60628227 CTATGTCAGATGCCATTTATAGG + Intronic
1071437833 10:85663166-85663188 CCAAGTGAGATCAAATTTATAGG - Intronic
1073741288 10:106409958-106409980 CTATGTAAGATCACATTCAGAGG - Intergenic
1077534534 11:3116208-3116230 TTAGGTCATATCAGAATTATAGG - Intronic
1079717638 11:23768530-23768552 CTAAGTCATATCAGAATTATGGG + Intergenic
1080087339 11:28300067-28300089 CTAGGTCAGATCACATTTATAGG + Intronic
1080932502 11:36826512-36826534 CAATGACAGTTCACATTTATTGG + Intergenic
1082060657 11:47857110-47857132 CTAGCTGAGATCACATTACTGGG + Intergenic
1082984504 11:59156883-59156905 CTAAATAAGGTCACATTTATAGG - Intergenic
1083358769 11:62089951-62089973 CTAAGTCATATCAGAATTATAGG - Intergenic
1085505751 11:77057916-77057938 TTAGGTCAGATCTCTTTTACTGG + Intergenic
1087047457 11:93854470-93854492 CTAAGTCATATCAGAATTATAGG + Intergenic
1087049753 11:93873988-93874010 CTAAGTCATATCAGAATTATGGG + Intergenic
1091865523 12:3832707-3832729 CTAGGCTAGGACACATTTATAGG + Intronic
1092904772 12:13091252-13091274 CTAGGTCAGATAACCTCTTTAGG - Intronic
1093498966 12:19788098-19788120 AAAGGTCAGATCACATATAAAGG - Intergenic
1095266339 12:40162837-40162859 CTAAGTCATATCAGAATTATAGG + Intergenic
1101086493 12:101241655-101241677 CTAGGTCAGCCCACACTCATGGG + Intergenic
1102132603 12:110543982-110544004 CAAGCTCAGATCACAGTTTTTGG - Intronic
1102843418 12:116151137-116151159 CTAGTTAAGATGAAATTTATGGG - Intronic
1106240609 13:27909749-27909771 TTAGGTCAGTTTACATATATAGG + Intergenic
1106334418 13:28770174-28770196 CTAAGTCATATCAGAATTATAGG + Intergenic
1106987930 13:35377612-35377634 CTAGCTCAGATCTCAGTGATTGG + Intronic
1109509324 13:63349266-63349288 CATGGTCAGAACAAATTTATAGG - Intergenic
1110446900 13:75595102-75595124 CTATGTCAAATCAATTTTATAGG - Intronic
1110809690 13:79798142-79798164 CTAGTTCAAAGCACATTTACAGG + Intergenic
1113234783 13:108259519-108259541 CAAGGTCAGTTCAGATTTAGGGG + Intronic
1115244194 14:31278292-31278314 CTAAGTCATATCAGAATTATAGG - Intergenic
1117721064 14:58629503-58629525 CATGGTCAGATAACATTTATGGG - Intergenic
1118320733 14:64751566-64751588 CAAGGTAAGATCAGAATTATAGG - Intronic
1118938673 14:70312222-70312244 CTAAGTCATATCAGAATTATAGG - Intergenic
1119953396 14:78769384-78769406 CCAAGTAAGGTCACATTTATAGG + Intronic
1120171335 14:81249369-81249391 CTAGGACAGATCTGCTTTATGGG - Intergenic
1121611107 14:95280801-95280823 CTAAGTCATATCAAAATTATAGG - Intronic
1122174048 14:99903575-99903597 CTAAGTCATATCAGAATTATAGG + Intronic
1122591857 14:102858696-102858718 CTAAGTCATATCACAATTCTAGG + Intronic
1124998333 15:34745789-34745811 CTAGAACAGCTCACATTTTTTGG + Intergenic
1130195851 15:81779729-81779751 TTAGGTCAGATCTCTTTCATTGG - Intergenic
1133680731 16:8117662-8117684 GCAGATCAGATCACATTTAAGGG + Intergenic
1133728473 16:8558552-8558574 CTAAGTAAGGTCACATTTATAGG + Intergenic
1140419833 16:74809598-74809620 CTAAGTCATATCAGAATTATAGG - Intergenic
1140459421 16:75127001-75127023 TTAAGTCAGATCAGAATTATAGG - Intergenic
1140625771 16:76793005-76793027 CTAGCTCAGAGCACATATTTAGG - Intergenic
1141518192 16:84560280-84560302 CTACATAAGATCACATTTACAGG + Intergenic
1142085663 16:88178953-88178975 CTGGGTCAGAGCACATATGTGGG + Intergenic
1142126018 16:88411115-88411137 CTAGGTAAGGTCACATTCGTAGG + Intergenic
1146441532 17:32900151-32900173 CTAAGTCATATCAGAATTATAGG + Intergenic
1147513319 17:41092690-41092712 CCAGGTCATATCAGAATTATAGG - Intronic
1148492654 17:48033284-48033306 CTAGGTGAGATTGCATTTTTTGG - Exonic
1153829386 18:8908184-8908206 CTAAGTCATATCAGAATTATAGG - Intergenic
1156054441 18:32981719-32981741 ATAGGTAAGATCACATTTAGTGG - Intronic
1157912804 18:51634638-51634660 CTAAGTCATATCAGAATTATAGG - Intergenic
926114758 2:10205342-10205364 CCAGGTCAGAACACATTTTGGGG + Intronic
931226041 2:60333161-60333183 CTAGGTAAGAAAATATTTATTGG - Intergenic
933427448 2:82130490-82130512 CTAAGTCATATCAGAATTATAGG - Intergenic
933614173 2:84466914-84466936 CTAAGTCATATCAAAATTATAGG + Intergenic
937564927 2:123273755-123273777 ATAGCTAATATCACATTTATTGG - Intergenic
941336290 2:164247896-164247918 CCAAGTCAGATCACATTCACTGG - Intergenic
943466726 2:188237728-188237750 CTAAGTCATATCAAAATTATAGG - Intergenic
944469979 2:200042512-200042534 CTAAGTCAGATTAGATTAATGGG - Intergenic
945787336 2:214258299-214258321 CTAGCTTAGCTCCCATTTATAGG + Intronic
945869514 2:215211671-215211693 CTAGGTCATATCAGAATTATAGG - Intergenic
947064388 2:226205395-226205417 TTTGTTCAGATCATATTTATTGG + Intergenic
947287796 2:228536631-228536653 CTAAGTCATATCAGAATTATAGG - Intergenic
1170381439 20:15764181-15764203 CTAGGTCATATCAAATTGAGTGG - Intronic
1171442041 20:25172490-25172512 CTAAGTCATATCAGAATTATAGG + Intergenic
1173135395 20:40434468-40434490 CTAAGTAAGGTCACATTCATAGG - Intergenic
1177358866 21:20043783-20043805 CGTGGTCAGAACAAATTTATAGG - Intergenic
1181441415 22:22937495-22937517 GTAGGTCAGAGCATATTTCTAGG + Intergenic
1183113595 22:35671766-35671788 CTAAGTCATATCATAATTATAGG - Intergenic
949780981 3:7687917-7687939 CTAGGACAGATCATGTTGATAGG - Intronic
950919070 3:16675641-16675663 CTAAGTCATATCAGAATTATAGG - Intergenic
951297899 3:20961677-20961699 CTAAGTCATATCAGAATTATAGG - Intergenic
952619905 3:35325581-35325603 CTAAGTCACATCAGAATTATGGG + Intergenic
955264363 3:57427240-57427262 CCATATAAGATCACATTTATAGG - Intronic
956379159 3:68647630-68647652 CTAAATAAGATCACATTTACAGG - Intergenic
956697721 3:71932833-71932855 CCAGGTAAGATCACATTTACAGG - Intergenic
957726098 3:84069418-84069440 CTAAGTCACATCAGAATTATAGG + Intergenic
959130656 3:102352082-102352104 TTAGGAAAGATCATATTTATTGG - Intronic
959910894 3:111762547-111762569 CTGGATCAGATCACACTTAGAGG - Intronic
960152114 3:114260723-114260745 CTAAGTCATATCAGAATTATAGG + Intergenic
961013726 3:123451400-123451422 CTAGGTCAGAGCAAAGTTCTGGG + Intergenic
964975045 3:162607733-162607755 CTAAATTAGATCACATTCATAGG + Intergenic
965438920 3:168688920-168688942 CTATGTCATGTCACATATATTGG + Intergenic
966721408 3:183066120-183066142 CTAAGTCATATCAGAATTATAGG - Intronic
969956447 4:10896010-10896032 CTAAATAAGTTCACATTTATAGG + Intergenic
970015017 4:11503737-11503759 CTAAGTAAGTTCACATTTACAGG - Intergenic
971913336 4:32825334-32825356 CTAAGTCACATCAGAATTATAGG + Intergenic
973776818 4:54250531-54250553 CTAAGTCATATCAGAATTATAGG - Intronic
973976689 4:56270028-56270050 TTGTGTCAGATCACATTTAAAGG - Intronic
974948409 4:68557115-68557137 CTAAGTCATATCAGAATTATAGG - Intronic
974957433 4:68659526-68659548 CTAAGTCATATCAGAATTATAGG - Intronic
975051539 4:69871177-69871199 CTAAGTCATATCAGAATTATAGG - Intergenic
975616987 4:76256515-76256537 CTAGGACACATCACCTCTATGGG - Exonic
977378536 4:96239236-96239258 CTAGGTCAGCTCCCATTCTTGGG - Intergenic
979024119 4:115546186-115546208 CTAAGTCATATTAAATTTATAGG + Intergenic
979031640 4:115655575-115655597 CTAAATCAGATCACATTTGAAGG + Intergenic
979203059 4:118002431-118002453 CAAGGTCATATTACATTTCTAGG - Intergenic
980071602 4:128248562-128248584 CTAAGTCATATCAGAATTATAGG + Intergenic
980321600 4:131286934-131286956 CTAGGTTATATCAGAATTATAGG + Intergenic
980593163 4:134917871-134917893 CCAGATCAGATCACATTCACAGG - Intergenic
982512384 4:156299327-156299349 CTATGTTACATAACATTTATAGG - Intergenic
986104262 5:4644676-4644698 CGTGGTCAGAATACATTTATAGG + Intergenic
986916703 5:12627987-12628009 TTATGTTAGATAACATTTATAGG - Intergenic
987047710 5:14123287-14123309 CTAGGAAAGATCACAATCATAGG + Intergenic
987873539 5:23650039-23650061 CTAGTTAAGATCACCTTTGTAGG + Intergenic
988569159 5:32346693-32346715 CTATGTCATATCAGAATTATAGG - Intergenic
988773909 5:34458666-34458688 CTAAGTCATATCAGAATTATAGG + Intergenic
990692625 5:58380502-58380524 CTAAGTCATATCAGAATTATAGG - Intergenic
995449895 5:112289106-112289128 CTTGGTCAGGTAACATTTAAAGG - Intronic
997140188 5:131371316-131371338 CTAGGTCAGTTCTCAGTTCTCGG + Intronic
1000078762 5:157823133-157823155 GTACGTCAGAACACATTTAGAGG - Intronic
1001046284 5:168374492-168374514 CAAGGTGTGATCACATTTAGCGG + Intronic
1002904216 6:1435803-1435825 CTAGGTCAGATGATAATTCTAGG - Intergenic
1004432518 6:15558070-15558092 CTAAGTCATATCAAAATTATAGG - Intronic
1004505389 6:16243017-16243039 CTAAGTAAGGTCACATTTACAGG + Intronic
1005322812 6:24671862-24671884 CTAGGTCATATCAGAATTACAGG + Intronic
1005651764 6:27891599-27891621 AGAGGTCAGATACCATTTATTGG - Intronic
1008291302 6:49719256-49719278 CTAAGTCATATCAAAATTATAGG + Intergenic
1011735470 6:90306039-90306061 CCAGGTCAGATCCTCTTTATAGG + Intergenic
1012558968 6:100555142-100555164 CTATGTTAGAAAACATTTATTGG + Intronic
1012910323 6:105110651-105110673 CTAGGTCATATGACATTAGTAGG + Intronic
1013758354 6:113486718-113486740 CTAGGTCAGATCTTCTTTAAGGG + Intergenic
1014411000 6:121120709-121120731 CTAGTTCAGAGAACAGTTATAGG + Intronic
1015814659 6:137195779-137195801 CCAGTTAAGATCACATTCATAGG - Intergenic
1017348548 6:153413131-153413153 CTAAGTCATATCAGAATTATAGG + Intergenic
1017386207 6:153887007-153887029 CTAAGTCATATCAGAATTATAGG + Intergenic
1017811016 6:157983438-157983460 CTACTTCATACCACATTTATCGG + Intronic
1022338912 7:29450301-29450323 CAAGGTAAGGTCACAGTTATTGG - Intronic
1030148829 7:106382516-106382538 CTAGGTCAGAGCACATGGTTAGG - Intergenic
1030428780 7:109415639-109415661 CTGGGTCAGATCAAAATTTTTGG - Intergenic
1031691189 7:124789941-124789963 CAAGGCCAGAACAAATTTATAGG - Intronic
1032487524 7:132298983-132299005 CTAGGTTAGTTCTCATTCATGGG - Intronic
1032898817 7:136282927-136282949 TTAGGTCTGATTACATTCATGGG + Intergenic
1032999423 7:137487047-137487069 CTGGTGCAGTTCACATTTATGGG + Intronic
1035964550 8:4176121-4176143 CAAGGGCAGTCCACATTTATAGG + Intronic
1036127665 8:6078168-6078190 CAAGGTGAGATCTCATATATGGG - Intergenic
1036744529 8:11395575-11395597 CTAGGACATATCAGATTTCTAGG + Intronic
1038364133 8:26913832-26913854 CCAAATCAAATCACATTTATAGG - Intergenic
1038453426 8:27655257-27655279 CTAGTTTACATCACATTTGTTGG - Intronic
1039596019 8:38790333-38790355 CTAGATAAGGTCACATTCATAGG + Intronic
1042623299 8:70729733-70729755 CTAAGTCATATCAGAATTATAGG + Intronic
1045428439 8:102090205-102090227 CTAAGTCATATCAGAATTATAGG - Intronic
1049066091 8:140315890-140315912 CTAAGTCATATCAGAATTATAGG - Intronic
1050256206 9:3794854-3794876 CTAGGTTGGATCACATTTAAGGG + Intergenic
1050990336 9:12142927-12142949 CTAAGTCATATCAGAATTATAGG - Intergenic
1052560471 9:30077985-30078007 CTATGTCATCTGACATTTATAGG - Intergenic
1056424210 9:86460396-86460418 CATGGTCAGAACAAATTTATAGG - Intergenic
1058384160 9:104413890-104413912 CTAAGTCATATCAGAATTATAGG - Intergenic
1058493978 9:105534348-105534370 CTAGTTCAGATCAAATTGAATGG + Intronic
1186202683 X:7170191-7170213 CTAGGTCTCATCATATTTCTTGG - Intergenic
1186588563 X:10903409-10903431 ATATGTCAGATCACTTTTCTGGG + Intergenic
1186786646 X:12962217-12962239 ATAGGTCAAATCACCCTTATGGG - Intergenic
1187950705 X:24467399-24467421 ATAGGTCAGAAGACTTTTATAGG - Intronic
1189116364 X:38347068-38347090 CTAGTTCAGAACCTATTTATTGG - Intronic
1190477802 X:50845201-50845223 CTAAGTCATATCAGAATTATAGG + Intergenic
1191768365 X:64727494-64727516 ATTGTTCAGCTCACATTTATAGG + Intergenic
1194310306 X:92298431-92298453 CTGTGACAGATCACATTTATTGG + Intronic
1194324283 X:92493523-92493545 CTAGGTCAAAACCCATTTTTAGG + Intronic
1194850477 X:98862860-98862882 CTAAGTCATATCAGAATTATAGG - Intergenic
1195225686 X:102790507-102790529 CTAAGTCATATCAGAATTATAGG + Intergenic
1195487194 X:105423076-105423098 CTAAGTCATATCAGAATTATAGG + Intronic
1197568313 X:128116429-128116451 CTAAGTCATATCAGAATTATAGG + Intergenic
1197830022 X:130631596-130631618 CTAGGTCAGTTCACTTTATTTGG + Intronic
1198498632 X:137220075-137220097 CGTGGTCAGAACAAATTTATAGG - Intergenic
1199538574 X:148931771-148931793 CTAGTTCAGAACACCATTATGGG + Intronic
1200618596 Y:5412717-5412739 CTGTGACAGATCACATTTATTGG + Intronic
1200633025 Y:5612744-5612766 CTAGGTCAAAACCCATTTTTAGG + Intronic