ID: 1080104721

View in Genome Browser
Species Human (GRCh38)
Location 11:28499978-28500000
Sequence TTGTTTAAAGGGCAGGTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080104716_1080104721 11 Left 1080104716 11:28499944-28499966 CCTTTTAATTAAAAGTAATAACT No data
Right 1080104721 11:28499978-28500000 TTGTTTAAAGGGCAGGTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080104721 Original CRISPR TTGTTTAAAGGGCAGGTGGT TGG Intergenic
No off target data available for this crispr