ID: 1080106658

View in Genome Browser
Species Human (GRCh38)
Location 11:28518240-28518262
Sequence TGCCACCCAGATGTGTCATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080106658_1080106662 16 Left 1080106658 11:28518240-28518262 CCACATGACACATCTGGGTGGCA No data
Right 1080106662 11:28518279-28518301 CTTTTGGGAAGGAACTATCCTGG No data
1080106658_1080106663 28 Left 1080106658 11:28518240-28518262 CCACATGACACATCTGGGTGGCA No data
Right 1080106663 11:28518291-28518313 AACTATCCTGGTTGTTATCATGG No data
1080106658_1080106661 5 Left 1080106658 11:28518240-28518262 CCACATGACACATCTGGGTGGCA No data
Right 1080106661 11:28518268-28518290 AGAAAGAAAGACTTTTGGGAAGG No data
1080106658_1080106659 0 Left 1080106658 11:28518240-28518262 CCACATGACACATCTGGGTGGCA No data
Right 1080106659 11:28518263-28518285 CTGTGAGAAAGAAAGACTTTTGG No data
1080106658_1080106660 1 Left 1080106658 11:28518240-28518262 CCACATGACACATCTGGGTGGCA No data
Right 1080106660 11:28518264-28518286 TGTGAGAAAGAAAGACTTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080106658 Original CRISPR TGCCACCCAGATGTGTCATG TGG (reversed) Intergenic
No off target data available for this crispr