ID: 1080110914

View in Genome Browser
Species Human (GRCh38)
Location 11:28566839-28566861
Sequence CGGGTGACTCAGAGCGCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080110907_1080110914 10 Left 1080110907 11:28566806-28566828 CCTTAATGACGTGAGCGCAGGCT No data
Right 1080110914 11:28566839-28566861 CGGGTGACTCAGAGCGCAGGAGG No data
1080110906_1080110914 11 Left 1080110906 11:28566805-28566827 CCCTTAATGACGTGAGCGCAGGC No data
Right 1080110914 11:28566839-28566861 CGGGTGACTCAGAGCGCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080110914 Original CRISPR CGGGTGACTCAGAGCGCAGG AGG Intergenic
No off target data available for this crispr