ID: 1080114026

View in Genome Browser
Species Human (GRCh38)
Location 11:28601696-28601718
Sequence ATGTGATTGTGTTAGGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080114026_1080114031 9 Left 1080114026 11:28601696-28601718 CCCACTTCCTAACACAATCACAT No data
Right 1080114031 11:28601728-28601750 AGATTTCAACATATTCATTTTGG No data
1080114026_1080114033 11 Left 1080114026 11:28601696-28601718 CCCACTTCCTAACACAATCACAT No data
Right 1080114033 11:28601730-28601752 ATTTCAACATATTCATTTTGGGG No data
1080114026_1080114032 10 Left 1080114026 11:28601696-28601718 CCCACTTCCTAACACAATCACAT No data
Right 1080114032 11:28601729-28601751 GATTTCAACATATTCATTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080114026 Original CRISPR ATGTGATTGTGTTAGGAAGT GGG (reversed) Intergenic
No off target data available for this crispr