ID: 1080121275

View in Genome Browser
Species Human (GRCh38)
Location 11:28680663-28680685
Sequence GTGGCTTCAGACCGATTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080121272_1080121275 -3 Left 1080121272 11:28680643-28680665 CCTTAAAGACAGACCTGGCTGTG No data
Right 1080121275 11:28680663-28680685 GTGGCTTCAGACCGATTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080121275 Original CRISPR GTGGCTTCAGACCGATTTGC AGG Intergenic
No off target data available for this crispr