ID: 1080122926

View in Genome Browser
Species Human (GRCh38)
Location 11:28698088-28698110
Sequence CAGCAAATAGCAGTTGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080122926_1080122940 28 Left 1080122926 11:28698088-28698110 CCAGCCTCAACTGCTATTTGCTG No data
Right 1080122940 11:28698139-28698161 TCTCTACTTGAACTGGGGGAGGG No data
1080122926_1080122929 -5 Left 1080122926 11:28698088-28698110 CCAGCCTCAACTGCTATTTGCTG No data
Right 1080122929 11:28698106-28698128 TGCTGCCCCCTGCTGGCATCTGG No data
1080122926_1080122936 23 Left 1080122926 11:28698088-28698110 CCAGCCTCAACTGCTATTTGCTG No data
Right 1080122936 11:28698134-28698156 GTACCTCTCTACTTGAACTGGGG No data
1080122926_1080122941 29 Left 1080122926 11:28698088-28698110 CCAGCCTCAACTGCTATTTGCTG No data
Right 1080122941 11:28698140-28698162 CTCTACTTGAACTGGGGGAGGGG No data
1080122926_1080122934 21 Left 1080122926 11:28698088-28698110 CCAGCCTCAACTGCTATTTGCTG No data
Right 1080122934 11:28698132-28698154 CAGTACCTCTCTACTTGAACTGG No data
1080122926_1080122937 24 Left 1080122926 11:28698088-28698110 CCAGCCTCAACTGCTATTTGCTG No data
Right 1080122937 11:28698135-28698157 TACCTCTCTACTTGAACTGGGGG No data
1080122926_1080122935 22 Left 1080122926 11:28698088-28698110 CCAGCCTCAACTGCTATTTGCTG No data
Right 1080122935 11:28698133-28698155 AGTACCTCTCTACTTGAACTGGG No data
1080122926_1080122939 27 Left 1080122926 11:28698088-28698110 CCAGCCTCAACTGCTATTTGCTG No data
Right 1080122939 11:28698138-28698160 CTCTCTACTTGAACTGGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080122926 Original CRISPR CAGCAAATAGCAGTTGAGGC TGG (reversed) Intergenic
No off target data available for this crispr