ID: 1080124450

View in Genome Browser
Species Human (GRCh38)
Location 11:28715924-28715946
Sequence CTGTCAAGAGTGCTGGTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080124450_1080124457 13 Left 1080124450 11:28715924-28715946 CCGTCCACCAGCACTCTTGACAG No data
Right 1080124457 11:28715960-28715982 GTATCTTAAATGGGATCCCTGGG No data
1080124450_1080124458 14 Left 1080124450 11:28715924-28715946 CCGTCCACCAGCACTCTTGACAG No data
Right 1080124458 11:28715961-28715983 TATCTTAAATGGGATCCCTGGGG No data
1080124450_1080124456 12 Left 1080124450 11:28715924-28715946 CCGTCCACCAGCACTCTTGACAG No data
Right 1080124456 11:28715959-28715981 AGTATCTTAAATGGGATCCCTGG No data
1080124450_1080124454 3 Left 1080124450 11:28715924-28715946 CCGTCCACCAGCACTCTTGACAG No data
Right 1080124454 11:28715950-28715972 AAGAGGCACAGTATCTTAAATGG No data
1080124450_1080124455 4 Left 1080124450 11:28715924-28715946 CCGTCCACCAGCACTCTTGACAG No data
Right 1080124455 11:28715951-28715973 AGAGGCACAGTATCTTAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080124450 Original CRISPR CTGTCAAGAGTGCTGGTGGA CGG (reversed) Intergenic
No off target data available for this crispr