ID: 1080133210

View in Genome Browser
Species Human (GRCh38)
Location 11:28820627-28820649
Sequence GGGCTTCTCTATAGGACAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080133210_1080133219 8 Left 1080133210 11:28820627-28820649 CCCTCTGTCCTATAGAGAAGCCC No data
Right 1080133219 11:28820658-28820680 AGGAACTAAGGGTGGCTTACAGG No data
1080133210_1080133220 30 Left 1080133210 11:28820627-28820649 CCCTCTGTCCTATAGAGAAGCCC No data
Right 1080133220 11:28820680-28820702 GCAACAGCCATCAGAAAATGAGG No data
1080133210_1080133216 -3 Left 1080133210 11:28820627-28820649 CCCTCTGTCCTATAGAGAAGCCC No data
Right 1080133216 11:28820647-28820669 CCCACTTAGCAAGGAACTAAGGG No data
1080133210_1080133214 -4 Left 1080133210 11:28820627-28820649 CCCTCTGTCCTATAGAGAAGCCC No data
Right 1080133214 11:28820646-28820668 GCCCACTTAGCAAGGAACTAAGG No data
1080133210_1080133218 0 Left 1080133210 11:28820627-28820649 CCCTCTGTCCTATAGAGAAGCCC No data
Right 1080133218 11:28820650-28820672 ACTTAGCAAGGAACTAAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080133210 Original CRISPR GGGCTTCTCTATAGGACAGA GGG (reversed) Intergenic
No off target data available for this crispr