ID: 1080145331

View in Genome Browser
Species Human (GRCh38)
Location 11:28976294-28976316
Sequence CTTCTCTCCCTGGCAGAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080145326_1080145331 25 Left 1080145326 11:28976246-28976268 CCTCGCTAACAACAAGATGTTCT No data
Right 1080145331 11:28976294-28976316 CTTCTCTCCCTGGCAGAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080145331 Original CRISPR CTTCTCTCCCTGGCAGAAAC AGG Intergenic
No off target data available for this crispr