ID: 1080150270

View in Genome Browser
Species Human (GRCh38)
Location 11:29044579-29044601
Sequence GGGAACCAGGATGGAGCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5131
Summary {0: 1, 1: 1, 2: 254, 3: 1155, 4: 3720}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080150264_1080150270 9 Left 1080150264 11:29044547-29044569 CCATAAAAAAAGAATGAGATCGT No data
Right 1080150270 11:29044579-29044601 GGGAACCAGGATGGAGCTGGAGG 0: 1
1: 1
2: 254
3: 1155
4: 3720

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080150270 Original CRISPR GGGAACCAGGATGGAGCTGG AGG Intergenic
Too many off-targets to display for this crispr