ID: 1080155962 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:29111403-29111425 |
| Sequence | TTGGGTAGAAACAGAATTGT AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1080155962_1080155968 | 26 | Left | 1080155962 | 11:29111403-29111425 | CCTACAATTCTGTTTCTACCCAA | No data | ||
| Right | 1080155968 | 11:29111452-29111474 | TTTATTATACTTTAAGTTCTGGG | 0: 4172 1: 11838 2: 19568 3: 8336 4: 4491 |
||||
| 1080155962_1080155967 | 25 | Left | 1080155962 | 11:29111403-29111425 | CCTACAATTCTGTTTCTACCCAA | No data | ||
| Right | 1080155967 | 11:29111451-29111473 | TTTTATTATACTTTAAGTTCTGG | 0: 1130 1: 3126 2: 3594 3: 2921 4: 3360 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1080155962 | Original CRISPR | TTGGGTAGAAACAGAATTGT AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||