ID: 1080155962

View in Genome Browser
Species Human (GRCh38)
Location 11:29111403-29111425
Sequence TTGGGTAGAAACAGAATTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080155962_1080155968 26 Left 1080155962 11:29111403-29111425 CCTACAATTCTGTTTCTACCCAA No data
Right 1080155968 11:29111452-29111474 TTTATTATACTTTAAGTTCTGGG 0: 4172
1: 11838
2: 19568
3: 8336
4: 4491
1080155962_1080155967 25 Left 1080155962 11:29111403-29111425 CCTACAATTCTGTTTCTACCCAA No data
Right 1080155967 11:29111451-29111473 TTTTATTATACTTTAAGTTCTGG 0: 1130
1: 3126
2: 3594
3: 2921
4: 3360

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080155962 Original CRISPR TTGGGTAGAAACAGAATTGT AGG (reversed) Intergenic
No off target data available for this crispr