ID: 1080165228

View in Genome Browser
Species Human (GRCh38)
Location 11:29227687-29227709
Sequence TAAGCATGTTTCCTTCTCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080165228_1080165231 9 Left 1080165228 11:29227687-29227709 CCACTGAGAAGGAAACATGCTTA No data
Right 1080165231 11:29227719-29227741 CTTTCTCCATCTTACGAGAAAGG No data
1080165228_1080165233 13 Left 1080165228 11:29227687-29227709 CCACTGAGAAGGAAACATGCTTA No data
Right 1080165233 11:29227723-29227745 CTCCATCTTACGAGAAAGGGAGG No data
1080165228_1080165232 10 Left 1080165228 11:29227687-29227709 CCACTGAGAAGGAAACATGCTTA No data
Right 1080165232 11:29227720-29227742 TTTCTCCATCTTACGAGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080165228 Original CRISPR TAAGCATGTTTCCTTCTCAG TGG (reversed) Intergenic
No off target data available for this crispr