ID: 1080165233

View in Genome Browser
Species Human (GRCh38)
Location 11:29227723-29227745
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080165228_1080165233 13 Left 1080165228 11:29227687-29227709 CCACTGAGAAGGAAACATGCTTA No data
Right 1080165233 11:29227723-29227745 CTCCATCTTACGAGAAAGGGAGG No data
1080165227_1080165233 19 Left 1080165227 11:29227681-29227703 CCTGATCCACTGAGAAGGAAACA No data
Right 1080165233 11:29227723-29227745 CTCCATCTTACGAGAAAGGGAGG No data
1080165225_1080165233 24 Left 1080165225 11:29227676-29227698 CCTAACCTGATCCACTGAGAAGG No data
Right 1080165233 11:29227723-29227745 CTCCATCTTACGAGAAAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080165233 Original CRISPR CTCCATCTTACGAGAAAGGG AGG Intergenic
No off target data available for this crispr