ID: 1080171719

View in Genome Browser
Species Human (GRCh38)
Location 11:29311652-29311674
Sequence CACTGATGTGATTTGAGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080171717_1080171719 6 Left 1080171717 11:29311623-29311645 CCATTCTGAACTGAAGGTGCCAA No data
Right 1080171719 11:29311652-29311674 CACTGATGTGATTTGAGCTCAGG No data
1080171714_1080171719 24 Left 1080171714 11:29311605-29311627 CCATTCGTCACCTCTCAGCCATT No data
Right 1080171719 11:29311652-29311674 CACTGATGTGATTTGAGCTCAGG No data
1080171715_1080171719 14 Left 1080171715 11:29311615-29311637 CCTCTCAGCCATTCTGAACTGAA No data
Right 1080171719 11:29311652-29311674 CACTGATGTGATTTGAGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080171719 Original CRISPR CACTGATGTGATTTGAGCTC AGG Intergenic