ID: 1080174354

View in Genome Browser
Species Human (GRCh38)
Location 11:29343886-29343908
Sequence GCGTATGCACAGAGGCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080174354_1080174357 -6 Left 1080174354 11:29343886-29343908 CCAGGCTGCCTCTGTGCATACGC No data
Right 1080174357 11:29343903-29343925 ATACGCAGTGCTCCGCTAGGTGG No data
1080174354_1080174359 13 Left 1080174354 11:29343886-29343908 CCAGGCTGCCTCTGTGCATACGC No data
Right 1080174359 11:29343922-29343944 GTGGCAGCACACTCTGCACCTGG No data
1080174354_1080174356 -9 Left 1080174354 11:29343886-29343908 CCAGGCTGCCTCTGTGCATACGC No data
Right 1080174356 11:29343900-29343922 TGCATACGCAGTGCTCCGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080174354 Original CRISPR GCGTATGCACAGAGGCAGCC TGG (reversed) Intergenic
No off target data available for this crispr