ID: 1080174583

View in Genome Browser
Species Human (GRCh38)
Location 11:29346795-29346817
Sequence GAGACGACTTTGGAGTTGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080174581_1080174583 -9 Left 1080174581 11:29346781-29346803 CCAGGTGATGGATTGAGACGACT No data
Right 1080174583 11:29346795-29346817 GAGACGACTTTGGAGTTGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080174583 Original CRISPR GAGACGACTTTGGAGTTGAT AGG Intergenic
No off target data available for this crispr