ID: 1080178428

View in Genome Browser
Species Human (GRCh38)
Location 11:29394518-29394540
Sequence GAACACTCCTTGAATAATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080178423_1080178428 27 Left 1080178423 11:29394468-29394490 CCTCTTACTAAAAGGAGGCAAAA No data
Right 1080178428 11:29394518-29394540 GAACACTCCTTGAATAATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080178428 Original CRISPR GAACACTCCTTGAATAATGC AGG Intergenic
No off target data available for this crispr