ID: 1080189815

View in Genome Browser
Species Human (GRCh38)
Location 11:29531017-29531039
Sequence AAGGGATCTAAAAATGCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080189808_1080189815 20 Left 1080189808 11:29530974-29530996 CCTGTCCTATATGCTGCAAAGGG No data
Right 1080189815 11:29531017-29531039 AAGGGATCTAAAAATGCTGTAGG No data
1080189810_1080189815 15 Left 1080189810 11:29530979-29531001 CCTATATGCTGCAAAGGGTCATG No data
Right 1080189815 11:29531017-29531039 AAGGGATCTAAAAATGCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080189815 Original CRISPR AAGGGATCTAAAAATGCTGT AGG Intergenic
No off target data available for this crispr