ID: 1080190283

View in Genome Browser
Species Human (GRCh38)
Location 11:29537238-29537260
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080190281_1080190283 1 Left 1080190281 11:29537214-29537236 CCTTTGGAGACAGCTATCTTGCT No data
Right 1080190283 11:29537238-29537260 AAGGTTACACAGATAAAACATGG No data
1080190279_1080190283 22 Left 1080190279 11:29537193-29537215 CCAAATGTACATTTTATTTTTCC No data
Right 1080190283 11:29537238-29537260 AAGGTTACACAGATAAAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080190283 Original CRISPR AAGGTTACACAGATAAAACA TGG Intergenic
No off target data available for this crispr