ID: 1080192481

View in Genome Browser
Species Human (GRCh38)
Location 11:29568804-29568826
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080192479_1080192481 3 Left 1080192479 11:29568778-29568800 CCAAAAGAGATCAAATCAGAGCA No data
Right 1080192481 11:29568804-29568826 GTTCAGCAGCACTATGCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080192481 Original CRISPR GTTCAGCAGCACTATGCTGT GGG Intergenic