ID: 1080192481 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 11:29568804-29568826 |
Sequence | GTTCAGCAGCACTATGCTGT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1080192479_1080192481 | 3 | Left | 1080192479 | 11:29568778-29568800 | CCAAAAGAGATCAAATCAGAGCA | No data | ||
Right | 1080192481 | 11:29568804-29568826 | GTTCAGCAGCACTATGCTGTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1080192481 | Original CRISPR | GTTCAGCAGCACTATGCTGT GGG | Intergenic | ||