ID: 1080196230

View in Genome Browser
Species Human (GRCh38)
Location 11:29612668-29612690
Sequence TGACCAGCAGGAGTCCCGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080196230_1080196238 24 Left 1080196230 11:29612668-29612690 CCCACCGGGACTCCTGCTGGTCA No data
Right 1080196238 11:29612715-29612737 CCTGACAATCCTTTTAGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080196230 Original CRISPR TGACCAGCAGGAGTCCCGGT GGG (reversed) Intergenic