ID: 1080196231

View in Genome Browser
Species Human (GRCh38)
Location 11:29612669-29612691
Sequence TTGACCAGCAGGAGTCCCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080196231_1080196238 23 Left 1080196231 11:29612669-29612691 CCACCGGGACTCCTGCTGGTCAA No data
Right 1080196238 11:29612715-29612737 CCTGACAATCCTTTTAGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080196231 Original CRISPR TTGACCAGCAGGAGTCCCGG TGG (reversed) Intergenic