ID: 1080196232

View in Genome Browser
Species Human (GRCh38)
Location 11:29612672-29612694
Sequence GGGTTGACCAGCAGGAGTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080196232_1080196238 20 Left 1080196232 11:29612672-29612694 CCGGGACTCCTGCTGGTCAACCC No data
Right 1080196238 11:29612715-29612737 CCTGACAATCCTTTTAGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080196232 Original CRISPR GGGTTGACCAGCAGGAGTCC CGG (reversed) Intergenic