ID: 1080196233

View in Genome Browser
Species Human (GRCh38)
Location 11:29612680-29612702
Sequence AGAGAGGAGGGTTGACCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080196233_1080196238 12 Left 1080196233 11:29612680-29612702 CCTGCTGGTCAACCCTCCTCTCT No data
Right 1080196238 11:29612715-29612737 CCTGACAATCCTTTTAGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080196233 Original CRISPR AGAGAGGAGGGTTGACCAGC AGG (reversed) Intergenic